Fonctionnement et fiabilité des tests RT-PCR pour la détection du SARS-CoV-2

Flash Presse
|

Le CNR des virus des infections respiratoires de l’Institut Pasteur est spécialiste de virus, comme par exemple ceux de la grippe et de la bronchiolite du nourrisson. En tant que centre expert en France, l’équipe du CNR est responsable notamment de la surveillance des cas d’infections respiratoires et du suivi des épidémies. De plus, lors de l’émergence d’un nouveau virus, comme le nouveau coronavirus en Chine, le CNR a pour mission de tout mettre en œuvre pour être en capacité de détecter ce nouvel agent pathogène.

Dans le cadre de la crise liée à la Covid-19, et dès l’apparition des premiers cas à l’international, et plus particulièrement en Europe (fin janvier 2020), le CNR de l’Institut Pasteur a développé un test de diagnostic permettant de détecter la présence du virus SARS-CoV-2 (à l’époque appelé nCoV-19) lors de suspicion de cas infectés.

Concernant les tests de diagnostic du CNR :

Le test de diagnostic nécessite tout d’abord la réalisation d’un prélèvement respiratoire, naso-pharyngé par exemple. De ce prélèvement est ensuite extrait l’ensemble des acides nucléiques présents (c’est-à-dire les éléments génétiques), afin de pouvoir détecter le potentiel virus par une méthode de biologie moléculaire, appelée RT-PCR, pour Reverse Transcriptase - Polymerase Chain Reaction.

Le test a été mis en ligne sur le site web de l’OMS pour garantir une meilleure diffusion dans le réseau mondial et être partagé avec la communauté scientifique. Sur ce site web, il existe 4 tests de diagnostic de référence, dont celui développé par le CNR de l’Institut Pasteur.

 

Qu’est-ce qu’un test RT-PCR ?

Les tests RT-PCR utilisés pour la détection des pathogènes, y compris le test développé par le CNR des virus des infections respiratoires à l'Institut Pasteur pour détecter le génome du SRAS-CoV-2, sont basés sur la réaction en chaîne par polymérase («PCR»).

Dans cette méthode, une petite séquence cible d’acides nucléiques (un fragment d’ADN) sera copiée de nombreuses fois, ce qui facilite sa détection. C’est lorsque cette amplification est détectée (par une sonde couplée à un fluorophore) que le test est dit positif.

La courte séquence d’acides nucléiques correspond à une infime partie du génome d’un organisme ou micro-organisme. L’objectif du test PCR est de détecter cette séquence afin de pouvoir confirmer si de l’ADN/ARN de l’organisme ou du micro-organisme est bien présent dans l’échantillon. Dans le cadre d’un test de détection pour confirmer ou infirmer une infection par un virus ou une bactérie, la présence des acides nucléiques du pathogène indique alors que la personne est bien infectée.

Le CNR a développé deux tests RT-PCR, respectivement IP2 et IP4, dans le cadre de l’épidémie de Covid-19. Ces deux tests utilisent chacun trois séquences distinctes du génome du SARS-CoV-2. Il s’agit de deux séquences « amorces » qui permettent l’amplification d’une courte séquence du génome du virus et d’une séquence « sonde » qui permet la détection en venant se fixer sur les séquences amplifiées à l’aide des deux amorces. Il faut donc une correspondance du matériel génétique dans le prélèvement avec les trois séquences simultanément pour obtenir un résultat positif. Si l’une de ces trois séquences ne se fixe pas, aucun signal n’est détecté, le résultat est négatif.

Dans le cadre du test IP2, les trois séquences sont :

- « CTCCCTTTGTTGTGTTGT » et « ATGAGCTTAGTCCTGTTG » qui comptent respectivement 18 et 17 nucléotides (ce sont les deux séquences amorces)
- et la séquence « AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1 qui compte 21 nucléotides (elle correspond à la séquence sonde).

Le génome complet du SRAS-CoV-2 comprend un enchaînement de 30 000 bases, et celui du génome humain, 3 milliards. Comme le code génétique ne comporte que 4 bases (A, T, C, G), il arrive parfois que de petites séquences de nucléotides se retrouvent dans différents organismes, comme c’est le cas pour la séquence « CTCCCTTTGTTGTGTTGT ». En effet, l’homme mais aussi d’autres espèces animales comme le labrador retriever, le chat, le cochon… possèdent cette séquence dans leur génome.

Par contre, l’association des trois séquences est unique au SARS-CoV-2 et c’est cette singularité qui permet l’identification du virus dans les tests.

 

Fiabilité du test RT-PCR

Pour garantir la performance du test lors de son développement, un système a permis de détecter si les trois séquences utilisées pour la reconnaissance du SARS-CoV-2 étaient  présentes dans d’autres organismes vivants. En ce qui concerne les tests RT-PCR développés par le CNR, les trois séquences ne sont pas présentes de manière simultanée chez un autre organisme que le SARS-CoV-2.

Ensuite, le test est validé sur des échantillons primaires (contrôles positifs et négatifs) pour vérifier la spécificité et la sensibilité du test (pas de faux positifs ou de faux négatifs). Les contrôles négatifs (ici par exemple des prélèvements nasaux ou de gorge antérieurs à 2019) permettent d’évaluer le risque d'amplification non spécifique.

Enfin, il est recommandé d’utiliser deux tests différents (au CNR de l’Institut Pasteur, ils sont respectivement nommés IP2 et IP4) sur un même échantillon afin de garantir la fiabilité du résultat. Il n’y aura donc plus seulement trois séquences du génome du virus à reconnaître et amplifier mais six séquences. Cela fournit une fiabilité supplémentaire aux tests RT-PCR.

 

 

AURÉLIE PERTHUISON
Responsable des relations presse

MYRIAM REBEYROTTE
Attachée de presse

NATHALIE FEUILLET
Chargée des relations presse

 

ENVOYER UN MESSAGE AU SERVICE DES RELATIONS PRESSE

 

Retour en haut