Press Brief 4 min read

Operation and reliability of RT-PCR tests in the detection of SARS-CoV-2

This article is over 5 years old

Published the Updated

The National Reference Center (CNR) for Respiratory Viruses at the Institut Pasteur specializes in viruses such as influenza and bronchiolitis in infants. As an expert center in France, the CNR is responsible for monitoring cases of respiratory infections and for epidemic surveillance. When a new virus emerges, like the novel coronavirus in China, the CNR's task is to do everything it can to detect the novel pathogen.

In response to the crisis caused by COVID-19, as soon as the first cases began emerging at international level, and especially in Europe (in late January 2020), the CNR at the Institut Pasteur developed a diagnostic test to detect the SARS-CoV-2 virus (known at the time as 2019-nCoV) in suspected cases of infection.

About the CNR's diagnostic tests:

The diagnostic test first requires the collection of a respiratory sample, for example from a nasopharyngeal swab. All the nucleic acids in this sample (in other words all the genetic material) are then extracted so that the potential virus can be detected using a molecular biology method known as RT-PCR (reverse transcriptase – polymerase chain reaction).

Details of the CNR's test were published online on the WHO website so that they could be shared with the global network and the scientific community. The WHO website lists four reference diagnostic tests, including the one developed by the Institut Pasteur's CNR.

 

What is an RT-PCR test?

RT-PCR tests used to detect pathogens, including the test developed by the National Reference Center for Respiratory Viruses at the Institut Pasteur to detect the SARS-CoV-2 genome, are based on the polymerase chain reaction (PCR).

In this method, a small target sequence of nucleic acids (a DNA fragment) is copied multiple times, which facilitates its detection. When this amplification is detected (using a fluorophore-labeled probe), the test is said to be positive.

The short sequence of nucleic acids corresponds to a minute part of the genome of an organism or microorganism. The aim of a PCR test is to detect this sequence so that it can be confirmed whether the sample contains any DNA/RNA of the organism or microorganism. In detection tests aimed at confirming or ruling out infection with a virus or bacteria, the presence of nucleic acids from the pathogen indicates that the subject is infected.

The CNR has developed two RT-PCR tests, known respectively as IP2 and IP4, for the COVID-19 epidemic. These tests each use three separate sequences from the SARS-CoV-2 genome: two "primer" sequences to amplify a short sequence of the viral genome, and a "probe" sequence, which enables detection of the virus by binding to the sequences that have been amplified by the two primers. The genetic material in the sample must correspond with all three sequences simultaneously for the result to be positive. If one of the sequences does not bind, no signal is detected and the result is negative.

The three sequences used in the IP2 test are:

- CTCCCTTTGTTGTGTTGT and ATGAGCTTAGTCCTGTTG, which have 18 and 17 nucleotides respectively (these are the two primer sequences)
- and the sequence AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1, which has 21 nucleotides (this is the probe sequence).

The whole genome of SARS-CoV-2 consists of a chain of 30,000 base pairs (the human genome has 3 billion base pairs). Since genetic code has just four bases (A, T, C and G), some small nucleotide sequences can be found in several different organisms. This is the case for the sequence CTCCCTTTGTTGTGTTGT, for example, which is found in the genome of humans and also other animal species such as Labrador Retrievers, cats and pigs.

But the association of the three sequences is unique to SARS-CoV-2, and it is this which enables the virus to be identified in tests.

 

Reliability of the RT-PCR test

To guarantee the performance of the test under development, scientists employed a system able to detect whether the three sequences used to recognize SARS-CoV-2 were present in other living organisms. With regard to the RT-PCR tests developed by the National Reference Center, the three sequences are not present simultaneously in any other organisms apart from SARS-CoV-2.

The test is then validated on primary samples (confirmed as positive and negative) to verify its specificity and sensitivity (no false positives or false negatives). Negative controls (here for example nose or throat samples taken before 2019) can help assess the risk of non-specific amplification.

Finally, it is advisable to use two different tests (the two tests developed by the CNR at the Institut Pasteur are named IP2 and IP4) on the same sample to guarantee the reliability of the result. This means that six sequences of the viral genome, rather than three, need to be recognized and amplified, thereby increasing the reliability of RT-PCR testing.

 

Nous contacter


L'équipe du service de presse peut vous aider en vous mettant en relation avec des porte-parole, en organisant des entretiens et en vous fournissant des informations sur les activités de l'Institut Pasteur.

Envoyer un message au service des relations presse
  • Aurélie PERTHUISON

    Head of the Press & Media Relations Office

  • Anne BURLET-PARENDEL

    Press Officer

  • Myriam REBEYROTTE

    Press Officer

  • Nathalie FEUILLET

    Media Relations Associate