Chapter 1. General introduction

Table of Contents

1.1. Running Python

1.2. Documentation

1.2.1. General informations
1.2.2. Getting information
1.2.3. Making documentation

1.3. Working environment

1.3.1. Emacs

1.1. Running Python

There are several ways to run Python code:

from the interpreter:

>>> dna = 'gcatgacgttattacgactctgtcacgccgcggtgcgactgaggcgtggcgtctgctggg'
>>> dna
'gcatgacgttattacgactctgtcacgccgcggtgcgactgaggcgtggcgtctgctggg'

from a file:

If file mydna.py contains:

#! /local/bin/python

dna = 'gcatgacgttattacgactctgtcacgccgcggtgcgactgaggcgtggcgtctgctggg'
print dna

it can be executed from the command line:

caroline:~> python mydna.py 
gcatgacgttattacgactctgtcacgccgcggtgcgactgaggcgtggcgtctgctggg

or using the #! notation:

caroline:~> ./mydna.py 
gcatgacgttattacgactctgtcacgccgcggtgcgactgaggcgtggcgtctgctggg

It is also possible to execute files during an interactive interpreter session:

caroline:~> python
Python 2.2.1c1 (#1, Mar 27 2002, 13:20:02) 
[GCC 2.95.4  (Debian prerelease)] on linux2
Type "help", "copyright", "credits" or "license" for more information.
>>> execfile('mydna.py')
gcatgacgttattacgactctgtcacgccgcggtgcgactgaggcgtggcgtctgctggg

or to load a file from the command line before entering Python in interactive mode (-i):

caroline:~> python -i mydna.py
gcatgacgttattacgactctgtcacgccgcggtgcgactgaggcgtggcgtctgctggg
>>>

this is very convenient when your Python file contains definitions (functions, classes,...) that you want to test interactively.

from other programs embedding the Python interpreter:

#include <Python.h>

int main(int argc, char** argv) {

  Py_Initialize();
  PyRun_SimpleString("dna = 'atgagag' + 'tagagga'");
  PyRun_SimpleString("print 'Dna is:', dna");

  return 0;
}


Python course in Bioinformatics		1.2. Documentation