29-bp repeats were found during the study of the non-coding region flanking the iap gene in E. coli (Nakata A. et al., 1989). This sequence contains a 7 bp-long dyad symmetry, and is repeated 14 times in this region, a 32 or 33 unconserved spacer is found between the repeats. About 24 kb downstream of iap are found two groups of 29 bp repeats, in the same intergenic region, separated by a 500 bp palindromic sequence, unique on the E. coli chromosome. The first group contains two 29 bp repeats, separated by 32 bp spacers, and the second has 7 repeats, also separated by 32 bp spacers. Similar repeats were not detected anywhere else on E. coli chromosome.
E. coli 29 bp repeats consensus
CGGTTTATCCCCGCTGGCGCGGGGAACTC
Similar sequences exist in Salmonella: they were first detected by Southern hybridisation, and we identified at least two regions in S. typhi sequences made available at the Sanger Centre.
In Salmonella, these repeats have a slightly different consensus as shown below :
S. typhi 29 bp repeats consensus
CGGTTTATCCCCGCTGGCGCGGGGAACAC
The organisation of the repeats also exhibits slight differences as compared to E. coli regions.
No similar sequences were detected on Klebsiella DNA by Southern hybridisation. A survey of Klebsiella DNA sequences made available at Washington University, St. Louis confirmed that this genome lacks similar sequences.
The genomes of archea contain sequences with similar structures ; in Archaeglobus fulgidus and Methanobacterium thermoautotrophicum are found several occurrences of 30bp-long sequences separated by 38 bp- or 36 bp-long spacers respectively.
A.f consensus : CTTTCAATCCCATTTTGGTCTGATTTCAAC
M.t consensus : ATTTCAATCCCATTTTGGTCTGATTTTAAC
In M. thermoautotrophicum, there are two regions containing 47 and 125 repeats respectively. In A. fulgidus there are two regions as well, containing 48 and 60 repeats respectively.
The presence of regularly spaced repeats in the genomes of several prokaryotes has been addressed recently (Mojica F.J.M. et al., 2000).
The function of these repeats has never been addressed experimentally.
Smith, D.R. et al. (1997) Complete genome sequence of Methanobacterium thermoautotrophicum delta H: functional analysis and comparative genomics. J. Bacteriol. 179, 7135-7155.
Klenk, H.P. et al. (1997) The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus. Nature 390 (6658), 364-370.
Back to the table of contents
Please send questions and comments to Sophie.Bachellier@pasteur.fr.