Oligonucleotides
 

 

Oligonucleotides used in the mapping and sequencing of the class2integron carried by pIP1100 

Oligonucleotide

  Sequence

Int1.R

ACATGCGTGTAAATCATCGTCG

Int1.F

GGGTCAAGGATCTGGATTTCG

I2.Up

GAATTCAAGACAAGGAGCGTTTTATG

I2.Dw 

GGATCCTACTTTTACTGATTGATAAGTAG

I3.Up

GAAT TCCTGTAAAGCATCATACTGG

I3.Dw

GGATCCCACAACCGTCATTCAGCC

aadA1

GGATCCGCGATCACCGCTTCCCTCAT

attI1.1

GAATTCGGCTTGTTATGACTGTTTTTTTGTAC

ereQ.L2

GGATCCAACCGGGATGCCTGAATCG

IereQ.L2

GGATCCCGATTCAGGCATCCCGGTTAT

ereASt.QL2

GCATGCGAGCTCCGGGTTATTGGCGAAGCGAACG

ereA1

GAATTCCTGGTTATTGGCGAAGCGAAAG

ereA2

GGATCCTATAGGGCAACCAGGCTG

M13fd

CGCCAGGGTTTTCCCAGTCAC

SatEnd

GAATTCGGATCCGTACTGGTTCTCGGGAGCACA

TnsE-Tn7

GAATTCGACATGTTTGGACGCCTTGGC

orfX-Tn7

GAATTCTTGGCCATTTATGACGACCAA