PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Streptococcus thermophilus

 

- Genes

The Streptococcus thermophilus MLST scheme uses internal fragments of the following six housekeeping genes:

  • ddlA (D-alanine--D-alanine ligase)
  • glcK (glucose kinase)
  • proA (gamma-glutamyl phosphate reductase)
  • ptsI (phosphoenolpyruvate-protein phosphotransferase)
  • serB (phosphoserine phosphatase)
  • tkt (transketolase)

- Primers for PCR amplification

ddlA : F : ddlA up : TCAAGTGTGGCTATGGA
ddlA : R : ddlA down : GTAGATGGCTCCATCCTC

glcK : F : glcKup : TGGGCAGAAACTCAAGA
glcK: R : glcKdown : AACACCACCACCGATAAC

proA : F : proA up : CCCGTCTCATCCAAACTGTG
proA : R : proA down : TGGTTGAAGTTAGGGCCTCA

ptsI : F : ptsI up : ACGTACTAGTCACTCTGCAA
ptsI : R : ptsI down : CACGAAGCAAGGCACGTAAT

serB : F : serB up : GGTCCAAGAAGAAGTAATTGA
serB : R : serB down : GACCTTATACAAATCTGGTT

tkt : F : tkt up: GCAGCACACCAATGGGTTACAC
tkt: R : tkt down : GGAGCACCATGACCAATG

- Sequencing primers

The same primers as for PCR are used.

- PCR conditions

PCR amplification is performed at an annealing temperatures of 54C for all genes.

- Allele templates

ddlA (450 bp)

CTTGAAGTTGCTGGAGTGCCACAGGTTGCCTACACAGGCTACATCGAGGGTGAAGATTTGGAAGCAGCAGTAGCAG AGACACTTGAAAAATTGACCTTCCCAGTTTTTGTCAAACCAGCCAACATGGGGTCATCTGTTGGGATTTCTAAAGC TGAAAATGAATCAGAGCTTCGTTCAGCGATTGATCTTGCTCTCAAATATGATAGCCGTATCTTGATTGAGCAAGGT GTAGTTGCTCGTGAAATCGAAGTTGGTATCCTTGGAAATACGACTGTCAAAACGACTGATCCGGGTGAAGTGGTCA AAGACGTGGCTTTCTATGATTACCAAGCCAAGTACATTGACAATAAGATTACCATGGATATTCCAGCTCGCGTGCC TGTCGAAGTCATGACGCAAATGCGTGCCTATGCGGCCAAGGCCTTTCGTGCTCTAGGGGGTTGCGGTCTT

glcK (450 bp)

CTTGGTATTCCATTCGCTATTGATAATGATGCTAATGTGGCTGCACTGGGTGAACGTTGGGTTGGTGCTGGTGCTA ACAATCGGAATGTTGTCTTTATAACATTGGGTACAGGTGTTGGTGGCGGTGTTATCGCTGATGGTAACTTAATTCA TGGTGTTGCCGGTGCTGGTGGGGAAATTGGTCACATTATTGTTGAACCTGACACAGGATTTGAGTGTACTTGCGGA AACAAGGGGTGTCTGGAAACTGTAGCTTCAGCAACAGGTATTGTACGTGTAGCACATCATTTGGCAGAAAAATACG AAGGAAACTCTTCTATTAAAGCTGCTGTAGACAATGGTGAGTTTGTGACAAGTAAAGATATTATCGTAGCTGCTAC TGAAGGTGATAAGTTTGCTGACATCATTGTTGATAAAGTCTCTAAATACCTCGGACTTGCAACAGCAAAC

proA (519 bp)

CCAGTCATCGAAACGGGTGTTGGTAACTGTCATATTTATGTGGATAAATATGCTAACTTAGATATGGCGACACAGA TTGTCATCAATGCCAAGACCCAACGACCAAGTGTGTGTAATGCTGCAGAATCTCTCGTTGTTCATGCTGATATTGT AGAAGAATTCTTGCCTAACTTGGAAAAAGCTATTTCAAAAATTCAGTCTGTTGAGTTCCGCGCGGATGAAAGGGCT TTGAAACTTATGGAAAAAGCTGTACCCGCTTTACCAGAGGATTTTGCGACAGAGTTTCTTGACTACATTATGTCTG TTAAAGTAGTAGACAGCCTTGATGAGGCGATTAATTGGATTAATACTTACACGACATCACATTCAGAAGCTATCGT GACTCAGGATATCAGTCGTGCTGAGCAATTCCAAGACGATGTTGACGCTGCAGCTGTCTATGTCAATGCCTCGACT CGTTTCACAGACGGTTTCGTCTTTGGACTGGGTGCTGAAATCGGAATCTCAACCCAAAAAATG

ptsI (501 bp)

GTCCTTGGAATAAACAACATAACTGAACTTGTTAAAGATGGTGACATTTTAGCGGTTTCAGGTATTACCGGTGAAG TTGTTATTAATCCAACTGAAGAACAAATTGCTGAGTTTAAAGCAGCTGGTGAAGCTTACGCCAAACAAAAGGCAGA ATGGGCTCAACTTAAAGATGCTCCAACAGTTACTGCTGATGGAAAACACTTCGAGTTAGCAGCAAATATCGGTACA CCTAAAGACGTTGAAGGTGTTAACGATAATGGTGCAGAAGCAGTTGGTCTTTATCGTACAGAATTCTTGTATATGG ATTCTCAAGATTTCCCAACCGAAGAAGACCAATATGAAGCATACAAAGCAGTTCTTGAAGGTATGAATGGTAAACC TGTTGTTGTTCGTACAATGGATATCGGTGGGGATAAAGAACTTCCTTACTTTGACCTTCCTAAAGAAATGAATCCA TTCTTGGGTTACCGTGCATTACGTATTTCTATCTCTGAAACTGGT

serB (498 bp)

GAGGCTGGTGTTGGTCGAGAGGTCGCTGAAATCACAGAGCGGGCCATGCGTGGAGAATTAGATTTCAGACAGGCTT TGAATGAGCGTGTGGCAACCCTTAAGGGATTGCCTGACAGTATATTTGAGAAGGTCTATGCCCGCATTCATTTCAA CAAGGGAGCCAAGGAACTTGTGGATGAACTCCACTCACGTGGCTTCAAGGTAGGTTTAGTTTCTGGTGGTTTCCAT GAGACAGTTGATAGACTGGCAAAAGAGGCAGGTATTGATTATGTGAAGGCCAATCACCTTGAGGTGATCGATGGTT TCTTAACTGGAAAGGTTTATGGTGAGATTGTTACCAAAGATGTCAAGGTAGCTAAGCTTAAAGATTGGGCAGCGGA AAATGGACTTAAGCTCTCTCAAACCATTGCTATGGGTGATGGAGCCAATGATTTGCCTATGATTAAGACAGCGGGT ATAGGCATCGCCTTTTGTGCCAAACCAATTGTCCGTGTACAA

tkt (525 bp)

CGTTTTGTTTTGTCAGCAGGTCATGGTTCAATGCTTCTTTATGCGCTCCTTCATTTGTCAGGATTTAAAGATTTGA GCATTGAAGAGCTTAAACAATTCCGTCAATGGGGTTCTAAGACACCTGGTCACCCAGAATTTGGCCATACAGTTGG TGTAGATGCTACGTCAGGTCCACTTGGGCAAGGTATTGCTATGGCTGTCGGTATGGCACAAGCTGAACGTTTCTTG GCTTCTCGATACAACAAGGAAGGCTTCCCAATCTTTGACCATTATACTTATGTTATTGCGGGAGATGGTTGCTTTA TGGAAGGCGTTTCGGCCGAAGCATCATCTTACGCTGGTCTTCAAAAATTGGATAAATTGATTGTCTTGTACGATTC AAATGATATCAATCTTGACGGTGAAACTAAAGATTCATTTACTGAAGATGTACGTGCACGTTATGAAGCTTATGGT TGGAACACTGAATTTGTTCAAGATGGAACAGATATTGAAGCTATCAACGCTGCTATTGAAAGTGCAAAA

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.