PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of kingella kingae

 

- Genes

The Kingella kingae MLST scheme uses internal fragments of the following six housekeeping genes:

  • abcZ (ABC transporter)
  • adk (adenosine kinase)
  • aroE (Shikimate dehydrogenase)
  • cpn60 (heat shock protein)
  • gdh (glutamate dehydrogenase)
  • recA (DNA repair)

- Primers for PCR amplification

abcZ : abcZ-F : TGACGACCAAGCGAGCGTGTTTGA
abcZ : abcZ-R : TCCGCCTCAACCGCCAATTCCT

adk : adk-F : CACAAGCGCAATTTATTACGCGCGA
adk : adk-R : GTCGTCATCGCGTTGCACCAAGT

aroE : aroE-F : TTTGCCGCACAAGAAGGTGCGCAA
aroE : aroE-R : GGCTGGTTCGCATAAAACATATCG

cpn60 : cpn60-F : TGTTGGCGCAAGCGATTGTTGCT
cpn60 : cpn60-F-3 : AAACCAATGATGTGGCTGGCGACG (For few strains, we use this forward primer in case of failure with the above primer)
cpn60 : cpn60-R : AATGGGCTGTCCAAACCAGCGAT

gdh : gdh-F : CGGCGCGTTGCGCGATATGGTGCA
gdh : gdh-R : CCAGTTGTCCAAAATCGGCATCAC

recA : recA-F : GACGAAGAATTGCAAGTCATTTCCA
recA : recA-R : AGTTTACGCAAGGCTTGGCTCATC

- Sequencing primers

The same primers as for PCR are used.

- PCR conditions

Conditions for housekeeping genes amplification were 15 minutes at 95C followed by 35 cycles of 95C for 15 s, 56C for 30 s and 72C for 1 min 30 s with a final extension step at 72C for 10 minutes.

- Allele templates (K. kingae ATCC23330 alleles)

abcZ (453 bp)

TTGGGCGATTTGCGCGATGTGTTGCGCCGTTATCATCAGGTTAGCCACGCGCTAGAAACGCAGCATTCTGATGATTTAATTCGCCA
ACTCAATGAGTTACAAAATGAAATTGAATCGCAAGACGGCTGGCAGTTTGACGCGGCAATCCGCCAAACGATTAGCGAATTGGGGC
TGCCTGAAAATGAATTGATTGGCAACTTGTCGGGTGGTCAGAAAAAACGGGTTGCGTTGGCTCAAGCGTGGGTGCAAAAACCCGAT
ATTTTGTTGCTGGACGAACCGACTAACCATTTGGATATTAACGCGATTATTTGGCTGGAAAATTTGTTGCAAGCGTTTTCAGGCAG
CATGGTGGTGATTACGCACGACCGCCGTTTTTTGGACAACATCGCCAATCGGATTGTGGAATTGGATAGGGGCGTGTTGCGTTCGT
ACGAGGGCAGTTTCAGCAAATAC

adk (351 bp)

ATTTCTACTGGCGATATGCTTCGCGCGGCGATTAAAGCTGGCACACCATTGGGTTTGGAAGCCAAAAAAATCATGGACGAAGGCG
GCTTGGTGTGCGATGACATCATCATCGGCATGGTCAAAGAGCGCGTGGCACAGCCCGATTGCGCCAATGGTTTTTTGTTTGATGG
CTTTCCACGCACCTTGGCACAAGCCGAAGCGATGATTGAAGCAGGTGTGCATTTGGACGCTGTGGTCGAAATCGACGTACCCGAC
GAAACAATCGTAGAACGCATGAGCGGTCGCCGTGTGCATTTGGCATCGGGTCGCACTTATCACTTGAAGCACAATCCGCCCAAAG
TGGCTGGCAAA

aroE (519 bp)

CGCACCTTTGCCGAAAACACCGCACAAGATTTTGGCGATGGCGTTCGCGCTTTTTTTGCACAAAATGGACGTGGAGCAAATGTGA
CCCTGCCGTTTAAAGGTTTTGCCTACGATTTGGTGCAGGCACACACCGAACGCGCTCGGGCAGCGGGCGCAGTCAATACGCTGAT
TCCGCAAGCAGACGGCACTTTGCTGGGCGACAACACCGACGGCGAAGGCTTGGTGCGCGACTTATGCCAGCACTTGCAATTCAAT
CTACACAATAAAAACATTTTGCTTTTGGGCGCAGGTGGCGCGACTCGTGGCGTGGTTTTGCCGCTAGCAGCCTGCAATCCTGCCA
GCATCACCATTGCCAATCGCACACACGATAAAGCCATTGAATTGGCTCAGTTGTTTGATATTGCCGCTCTGCCCTTTCATCAATT
AAATCAATCTTATGACATTATTATCAACGCAACATCGGGTAGCATAGACGATAGCATTCCAGATGTATCGCCCGATATTTTTGCA
GGCTGCTCG

cpn60 (303 bp)

GTTACCGCAGGCATGAATCCTACCGATTTGAAACGCGGTATTGACAAAGCAGTGGCGGCTTTGGTTGGCGAATTGGCAAACATCG
CGAAACCTTGCGAAACATACGAGCAAATCGCTCAAGTGGGCGCGATTTCTGCGAACTCTGACGAGCAAGTTGGCAAAATCATTGC
AGACGCGATGCAAGAAGTCGGCAAAGAGGGCGTGATTACCGTTGAAGACGGCAAATCATTGGAAAACGAGTTAGAAGTGGTTAAA
GGTATGCAATTTGACCGTGGCTACTTGTCGCCTTATTTCGTGAATGAT

gdh (576 bp)

ATGCAAATGCTGTGTTTTGTGGCAATGGAACAACCCAAATCGTTGAGCGCAGACGATGTACGCGATGAAAAATTGAAAGTGGTGG
CTGCACTCAAACCGATGACTTCGGCAGATGTAGATAAAAACGTGATTCGCGCACAATATGTGGCAAACGGCGAGCAAAACGGCTA
TTTGCAAGAACACAATGTGCCAGCCGACAGCCGTACCGAAACCTATGTTGCCATTCGCGCCGAAATTGATACGCCACGTTGGGCA
GGCGTGCCGTTTTATTTGCGTACAGGCAAACGCTTGGCAACGCGCACAGCAGAAATTGTTTTGAATTTCAAAGACCAAGCCAATG
GTTTGTTTGGCACAAATCCTAATCGTTTGGTGATTTCGTTGCAGCCCGATGAAACCGTATCGCTCAAATTGTATGTGAAACAAGT
GGGCAGCGGCTTGGACGTGCAGCCAACCGAAATGGTGTTGGACATGGGCACAGTGTCAGACGAACGCCGCGCCGAAGCGTATGAA
TTGCTGTTGCGCGAAGTGATTGACGGACGTTTGAGCTTGTTCAATCGCCGCGACGAGCTGGAAAAA

recA (354 bp)

TTGGACATTGCCTTGGGTGTGGGCGGTTTACCACGTGGTCGTATTGTGGAAATTTACGGCGCAGAATCATCGGGCAAAACCACTT
TATGTTTGGAATCGATTGCACAATGCCAAAAAGCAGGCGGAACGTGTGCGTTTATTGACGCAGAACACGCATTTGACCCTATTTA
CGCGCGTAAATTGGGCGTAGAAGTCGAAAAATTGTTGGTATCGCAACCCGACACAGGCGAACAAGCTTTGGAAATTTGCGATATG
TTGGTGCGCTCGGGCGGTGTGGATATGGTCGTGATTGATTCGGTTGCCGCACTTGTTCCCAAAGCGGAAATTGAAGGCGACATGG
GCGACAGCCACGTT
 
Portail Institut Pasteur Accueil Debut de Page
Databases are maintained by Sylvain Brisse, Ghislaine GUIGON and Jean-michel THIBERGE using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). For any suggestion, please contact pf8-bioinfo

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.