PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Mycobacterium abscessus

 

- Genes

The Mycobacterium abscessus MLST scheme uses internal fragments of the following seven housekeeping genes:

  • argH (argininosuccinate lyase)
  • cya (adenylate cyclase)
  • glpK (glycerol kinase)
  • gnd (6-phosphogluconate deshydrogenase)
  • murC (UDP N-acetylmuramate-L-Ala ligase)
  • pta (phosphate acétyltransférase)
  • purH (phoshoribosylaminoimiazolcarboxylase ATPase subunit)

- Primers for PCR amplification

argH : ARGHF GACGAGGGCGACAGCTTC
argH : ARGHSR1 GTGCGCGAGCAGATGATG

cya : ACF : GTGAAGCGGGCCAAGAAG
cya : ACSR1 : AACTGGGAGGCCAGGAGC

glpK : GLPKSF1 : AATCTCACCGGCGGTGTC
glpK : GLPKSR2 : GGACAGACCCACGATGGC

gnd : GNDF : GTGACGTCGGAGTGGTTGG
gnd : GNDSR1 : CTTCGCCTCAGGTCAGCTC

murC : MURCSF1 : CGGACGAAAGCGACGGCT
rmurC : MURCSR2 : CCAAAACCCTGCTGAGCC

pta : PTASF1 : GATCGGGCGTCATGCCCT
pta : PTASR2 : ACGAGGCACTGCTCTCCC

purH : PURHSF1 : CGGAGGCTTCACCCTGGA
purH : PURHSR2 : CAGGCCACCGCTGATCTG

- Sequencing primers

The same primers as for PCR are used.

- PCR conditions

Conditions for housekeeping genes amplification were 5 minutes at 94°C followed by 30 cycles of 94°C for 1 minute, 58°C for 1 minute and 72°C for 1 minute with a final extension step at 72°C for 10 minutes.

- Allele templates (M. abscessus CIP104536T alleles)

argH (480 bp)

GTGAGCACCAACGAAGGCTCGCTGTGGGGCGGCCGGTTCGCCGGCGGCCCAGCCCCGGCGCTGGCGGCATTGAGCAAATCCACTC
ATTTCGATTGGGCGCTGGCGCCTTACGACATTCAGGCGTCGGTTGCTCATGCCCGAGTGCTCCGCAAGGCGGGCCTGCTCACCGA
TGAACAACTCGGTGCCCTGGTCGAGGGCTTAGAGCAGCTGGGTCGGGATGTCGCGTCGGGCGTGTTCGTCCCAGCCGATACCGAC
GAGGACGTACACGGTGCCCTCGAACGCGGGTTGATCGAACGGGTGGGCCCTGACATCGGCGGCCGTCTCCGTGCCGGCCGATCCC
GAAACGATCAGGTGGCCACACTGTTTCGGATGTGGCTGCGCGACGCGGCCGGACGCATCTCCGAGGGCGTGCTCGACGTCGTGCA
GGCATTGGCGGATCAGGCCGGGGCACATCCGGATGCGATCATGCCGGGCAAGACT

cya (510 bp)

CTGGTGGGGTCCACCCAGTTGGCGTCCACTCGGGGGCCTGCGGTGGTCGTACGGGTGCTCAACGAGTTCTTCCGGGTCATCGTCG
ACACCGTCAACAAGCACGGCGGCTTCGTGAACAAGTTCCAGGGTGACGCGGCGCTGGCGATTTTTGGTGCCCCGATCGACCACCC
GGACGGCGCCGCAGCGGCACTTGCGGCCGCTCGTGAGCTGTCGGGCGAGCTGACCAATGTGTTGGGCTCCAATGACTTCGGCATA
GGAGTCTCCGCCGGACGGGCGATCGCCGGGCATATCGGCGCACAGGCCCGATTCGAGTACACCGTGATCGGCGACCCGGTGAACG
AAGCGGCCCGACTCACCGAGCTGGCTAAGAACGAGCCGGGCAACGTGCTCGCGTCGGCCTCCGCAGTCATGGAGGCGCGCGACGA
GGAGGCACTGCGCTGGGATGTCGGCGAGACCGTCGAACTGCGCGGCCGCACGGTCTCAACGCAGGTTGCGCGCCCGCGTCACGGC

glpK (534 bp)

GTGACAAATGCCAGTCGCACCATGTTGATGAACCTGGAGACCCTGGACTGGGATGACGAGCTGTTGTCGTTCTTTTCCATTCCGC
GCCAGATGCTTCCGCCGATCAAGGCGTCGTCGCCGGTGGAGCCGTTCGGCTTCACGACGCAGCTGGGTCCGCTGGGCGGAGAGGT
TCCCATCGCCGGCGATCTGGGTGATCAGCAGGCCGCGATGGTGGGGCAGGTGTGCCTGAACCCCGGCGAGGCCAAGAACACCTAC
GGCACCGGAAACTTCTTGCTACTCAACACCGGTGAGGAACTGGTCCATTCGAGCAATGGGCTGTTGACCACCGTCTGTTATCAAT
TCGGCGACAACAAGCCGGTGTATGCGCTGGAGGGATCGATCGCGGTGACGGGCTCCGCGGTGCAGTGGCTGCGCGACCAGCTGGG
CATCATCAGCGGTGCCTCGCAAAGCGAGGACCTGGCGCGCCAGGTCGAGGACAACGGCGGCGTCTATTTCGTGCCGGCCTTTTCC
GGGCTGTTCGCGCCGTACTGGCGA

gnd (480 bp)

CAGTTCGTTGAAGATGTGCGCCAAGCGCTGTACGCCTCCAAGATCGTGGCCTACGCCCAGGGGTTCAACCAGATCGCGGCGGGC
AGCGCCGAGTACGGCTGGAACGTCAGCCCTGGCGATCTGGCCACCATTTGGCGTGGCGGCTGCATCATCCGCGCGCAGTTCCTCA
ATCGGGTCAAAGAAGCATTCGCCGATCGGCCGGACCTGGCCACGCTGATCGCGGCACCGTACTTCCGCGACGCCGTCGAGAAGGG
CATCGACAGCTGGCGGCGCGTGGTGGTCACCGCCACCCAGCTGGGTATTCCGGTACCAGGCTTCGCCTCGTCGCTGTCTTACTAC
GACGGTCTGCGTACCGATCGCCTGCCCGCCGCACTGACCCAGGCGCAACGCGACTTCTTCGGTGCCCACACCTATGAGCGCATCG
ACGCCCCCGGCAAGTTCCACACGCTCTGGAGCGGCGACCGCAACGAAGTAGAGGCG

murC (537 bp)

CCGAACCTGATCATCGTGACCAATATCGAGGCGGATCACCTGGATCACTTCGGCAGCGTGGAGGCTTACTCCGCGGTGTTCGA
CGAATTCGCCGAAACCCTGGGTTCCGAAGGGGTGTTGGTGGTGTGTCTGGATGACCCGGGTGCCGCGGCGCTGGCCCGCCGGGCA
CATGAGCGCGGTATCCGGGTGCGCGGCTACGGCAGCGCCGACCAGGCCGAGGCGGGCGATGTCCCGGTGGCGGGGCAACTGCGGG
ATTGGCAGTTCAAGGACACCGGGGCCACCGCGCAGATCCAGCTGGCGGGGGAGAGCGCGCCGCGGACCATGCGGTTGTCGGTACC
GGGCCGGCATATGGCCCTGAACGCACTGGCCGCCGTGGTGACGGCCGCCGAGATCGGGGCGGCCGTCGACGATGTCCTGGACGGA
TTGGCCGGATTCGAGGGTGTGCGCCGCCGATTCGAACTGGTCGGGTCGGTGGAGTCGGTGCGGGTTTTCGATGACTATGCGCACC
ATCCCACCGAGGTGCGTACGGTGCTGCAG

pta (486 bp)

GACGTACTACTCGCCGTGGCAAGTGCGCATGTGGCAGAAGGCTTTCCGTCGCTATCGGCCATCATCTTGAATGGTGGGCTCAAG
CTGCACCCGCGCATCGCAGATCTGGTGGACGGTATCGGGCTGCGGTTGCCGATCATCGAGACGGACTCCGGCACCTTCGAGACCG
CGAGCGCGGCCGCGCATGCGCGTGGCCGGGTGACGGTGGCTTCTGCGCGCAAGATCGATACCGCGCTCGCGCTGATGGACAGGTA
CGTGGATGGCGCGGATCTCGTTGCGCAGCTCGCTATCCCGATACCGTCGGTTACCACGCCGCAGATGTTCGAGTACCAGCTGCTG
GACCGGGCACGCGACAACCGCAAGCGCATCGTGTTGCCCGAGGGCGACGACGACAGGATTCTCAAGGCCGCCGGCCGGCTATTGC
AGCGTCAGGTCGCCGACCTGACGATCCTGGGCGAAGAGGCCGAAATCCGCTCCCGTGCCGCC

purH (549 bp)

AAGGTTTTGGCTGCCAAGGCGTTCCGGCACACCGCAGAATACGATGTGGCGGTCGCGGGGTGGCTCTCCGGTGTGGCAGAGCCC
GGGGACGCCGAGCTGCCCTCATGGATCGGCGGCACGTGGAACCGTTCGGCGGTGCTGCGCTATGGAGAGAACCCGCACCAGCAGG
CGGCCCTGTATATCGGTGCCGCCGGGCAGGGCCTTGCTCAGGCCGAGCAGCTGCACGGAAAAGAGATGTCGTACAACAACTACAC
CGACGCCGACGCCGCGTGGCGTGCCGCATGGGATCAGGACAAGGCATGCGCGGCGATCATCAAGCACGCCAACCCATGTGGTATC
GCGGTGTCGGACATCTCGATTGCCGATGCGCACCTCAAGGCGCACGAATGCGATCCATTGAGTGCGTTCGGCGGCGTGATCGCCG
TCAACCGTGAGGTGAGTGTGGAGATGGCCGAGCGGGTGGCCGACATCTTCACCGAGGTGATCGTGGCCCCGGGGTACGCCGATGG
CGCCGTCGAGGTGCTGAGCCGCAAGAAGAACGTGCGGCTG
 
Portail Institut Pasteur Accueil Debut de Page
Databases are maintained by Sylvain Brisse, Ghislaine GUIGON and Jean-michel THIBERGE using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). For any suggestion, please contact pf8-bioinfo

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.