PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Staphylococcus lugdunensis

 

- Genes

The Staphylococcus lugdunensis MLST scheme uses internal fragments of the following seven housekeeping genes:

  • aroE (shikimate dehydrogenase)
  • dat (D-amino acid aminotransferase)
  • ddl (D-alanine:D-alanine ligase)
  • gmk (guanylate kinase)
  • ldh (L-lactate dehydrogenase)
  • recA (recombinase)
  • yqiL (acetyl-CoA acetyltransferase)

- Primers for PCR amplification

aroE- F : ATCGGAGATCCGATTTCACATTC
aroE- R : GGCGTTGTATTAATTATAATATC

dat - F : TCGTGGTTATGTTTTTGGTGACGGT
dat - R : CTATGAGAAGTAAAGCCAGGAAT

ddl - F : AGTGCGGAGCACGACGTTTCA
ddl - R : ACACTTGATCCCAAATTCGCCGGT

gmk - F : ATAGTTCTTTCCGGACCATC
gmk - R : TCATTGACTACAACGTAATCATA

ldh - F : ACTTGCAGGTGCCACGTCGA
ldh - R : GCTACGCATTTGCAATGGTAACGCA

recA - F : GCACGGCCACCAGGTGTTGT
recA - R : AGGCCGTCGCGTATCTAGTGT

yqiL - F : GTGCTAAACGCACACCAATTGGA
yqiL - R : CTTCAGCATCGATTAGAGGCAC

- Primers for Sequencing

The same primers as for PCR are used.

- PCR conditions

The PCR mixtures were heated for 3 min at 95C, then a touch-down procedure followed, consisting of 30 s at 95C, annealing for 30 s at temperatures decreasing from 60C to 50C during the first 11 cycles (with 1C decremental steps in cycles 1 to 11), and ending with an extension step at 72C for 30 s. A total of 40 cycles were performed

- Allele templates

aroE(459 bp)

AATGCTAACTTTAAAGCCCTTAATATGAGACATACGTATGAAGCTATTCATGTTCCAAGAGAACACTTTCATCATATTAAAGACATTATA GCCGAAAAGGAAATTGATGGTTTTAACGTGACAATACCTCACAAAGAAGCCATCATTCCATACTTAGATGTTATAGATGATACTGCTAAA AACATAGGAGCAGTGAATACCATTGCAATAAAACAAGGTAAATGGATTGGCTACAATACAGATGGTATAGGTTATGTAACTGGGTTAAAG CATATTTATCCTGATATTGAGCATGCCTACATATTGATACTAGGTGCTGGAGGTGCCAGTAAAGGCATTGCCCATGAACTTATAAAATAC GTTGAACCTAAAATAACGATAGCCAATCGGACAGCTAAACGTTTTGATTCATGGACTTTAGACGTAAATAAAATTTCGTTGGAAACCGCT GAACGACAT

dat (410 bp)

GCATATAAAGGTAAATTATTTACAGTCGAAGAACATTTTGATAGATTTTTACGCAGTGCAGATGAAATAGGTTTAGATTTAGGCAAAACT AAAGAAGAACTTATTGACATAACACGCCAGTTACTAAAAGAAAATCAAATAGAAACTGGTGGCATTTATATTCAAGCAACACGTGGTGTG TCACCACGTAATCATTCATTTCCAATACCAGAAGTTAAGCCGGTTATTACAGCATTTGCTAAAAGTTACGATCGCCCATATGAAGAATTA CAGAATGGCGTTAGCGCAGTCACAGTTGAAGATATACGTTGGTTAAGATGTGACATTAAAAGTCTAAACTTACTAGGTAACGTATTGGCA AAAGAATATGCGGTTAAATATAATGCTACAGAGGCGATTCAGCATCGCGG

ddl (421 bp)

CAAAATGTATTAAATGCTATTGATAAAGAAAAATATTTAGTGGACATTATTTATATAACAAATGATGGTTTATGGAAAAAGAAAGGTAAC ATAACAGCAACGATTGAATCTCCAGAAGAACTTACTTTAACAGATGTTGAGCCAGAAGATATTACTTTATTATTAAAACAAAGTAGTGCT GGTGAAGCATATGATGCAGTATTTCCACTATTACATGGACCTAATGGGGAAGACGGTACGATACAAGGTCTGTTTGAAGTATTGGATATT CCATATGTCGGAAATGGCGTGTTAGCTGCTTCTAGCTCAATGGATAAGCTTGTAATGAAACAATTGTTTGAGCATAGAGGGCTACCACAA TTACCTTATATTAGTTTTTTACGCAGTGAATATGAAAAGTATCAAGGAAATATCATTAAAT

gmk (431 bp)

CAAATATTTGATGATCCAACCACATCATATAAGTACTCTATATCTATGACAACACGTGATAAACGTGATGGAGAAATCGATGGCGTAGAT TATTTTTTTAAGACGAAAGAAGAATTTGAAACATTAATACAACAAGATCAGTTTATCGAATATGCTGAATACGTTGGTAATTACTATGGC ACACCTGTTCAATATGTCAAAGATACGATGGAAGCTGGACATGATGTTTTCTTAGAGATTGAAGTTGAAGGTGCTAAGCAAGTAAGGAAG AAATTCCCGGACGCACTTTTTATATTTTTAGCGCCACCAAGTTTAGAACATCTAAGAGAAAGATTAGTAGGTCGTGGTACAGAATCCGAT GAAAAGATTCAAAAACGTGTAAGTGAGGCACGTAAAGAAGTAGAAATGATGAATTTGTATGATTACGTTGT

ldh (412 bp)

GTAAACGTGCACTATCTAGTACAGTGCCTGAACCAATAACGCGTTCTGCTGGTAGGCCTGTATATTCTTTAATGAAGCGTGTTAGGATAT CAACTGGATTTGCTGCAATTAAGAAGTAGCCGTCAAAGCCACTATCCATCACGCTTTTCACAATATCTTTCATGATTTTAGCGTTTTTCT CTACTAATTGTAAACGTGTTTCACCAGGTTTTTGCGGTGCGCCAGCTGTAATGACCACTAAATCAGCATCTTTACAGTCTGAATATGTAC CCGCACTTATGTTAACTGGAGAAGGACAATGGGCTGTCCCATGGTTTAAATCTTGAACATCAGCATTGACTTTATCCGTTGCAATATCAA TAATCACAAATTCATCAGCTACACTTTGCGTTACCATTGCAAATGCGTATGA

recA (461 bp)

AAAATGGCTGTCGTATTTGATTTAGAAATTGCACCTGAAAGCTTACGTAATGCTTGAGACATCAAGCGAGCTTGTAAACCTACATGCGTA TCTCCCATTTCTCCTTCAATTTCAGCTTTAGGTGTTAAAGCTGCAACTGAGTCCACAACTACAATATCAACAGCTCCACTACGTACAAAG GCTTCAGCGATTTCTAAACCTTGTTCACCATGATCTGGTTGAGAAAGATATAAGTTATCAATATCTACACCTAAAGCAGCTGCATATTCA GGATCTAACGCATGCTCAGCATCAATAAAAGCTGCAATACCACCATTTTTTTGAACTTCGGCAATTGCATGTAATGCAACGGTCGTTTTA CCTGAACTTTCAGGACCATATATTTCTATAATTCTTCCTTTAGGATATCCACCAACTCCTAAAGCATTATCTAATGTCACTGATCCAGTA GATACACTACG

yqiL (443 bp)

TATTCAGCAGTTGAACTAGGAACAGCAGCTTTAAAAGCAGCAGTAGAAGCTATTGATATTGATCCAAGTACAATTCAACAAGTCATTTTT GGTAACGTTCTTCAAAGTGGGGTTGGTCAAAATCCAGCACGTCAAATTGCTATTAAAGCTGGGTTACCTAACACGCCACCGGCAATGACA ATAAACGAGGTATGTGGTTCAGGCCTTAAAGCAATTATTTTAGGCAAGCAATTAATACAATTAGGCGAAGCAAAAGTTGTGGCAGTTGGT GGTGTTGAAAGTATGACAAATGCACCACAGTTGATTTTAAAAGAAGGACAAGACCCTGTAGAAAGTTTTATGCATGATGGTTTAACCGAT GCTTTCCATTATGTTCCAATGGGTGTGACTGCTGAAAACATTGCAGAAAAATATCATATTAGTCGAGAAATGCAAGATGCGTT

 
Portail Institut Pasteur Accueil Debut de Page
Databases are maintained by Sylvain Brisse, Ghislaine GUIGON and Jean-michel THIBERGE using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). For any suggestion, please contact pf8-bioinfo

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.