PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of

Plesiomonas shigelloides

 

- Genes

The Plesiomonas shigelloides MLST scheme uses internal fragments of the following five housekeeping genes:

  • fusA (GTP-binding protein chain elongation factor EF-G)
  • leuS (leucine tRNA synthetase)
  • pyrG (CTP synthetase)
  • recG (DNA helicase, resolution of Holliday junctions, branch migration)
  • rpoB (beta-subunit of RNA polymerase)

- Primers for PCR amplification and sequencing

fusA:F:fusA3 CATCGGTATCAGTGCKCACATCGA
fusA:R:fusA4 CAGCATCGCCTGAACRCCTTTGTT

leuS:F:leuS3 CAGACCGTGCTGGCCAACGARCARGT
leuS:R:leuS4 CGGCGCGCCCCARTARCGCT

pyrG:F:pyrG3 GGGGTCGTATCCTCTCTGGGTAAAGG
pyrG:R:pyrG4 GGAACGGCAGGGATTCGATATCNCCKA

recG:F:recG3 GGGCGACGTTGGCTCMGGKAAAAC
recG:R:recG4 GGGTGCGGGGGATSGGSGTKGC

rpoB:F:Vic4 GGCGAAATGGCDGARAACCA
rpoB:R:Vic6 GARTCYTCGAAGTTGTAACC

- Sequencing primers

The same primers as for PCR are used.

- PCR conditions

* PCR amplification is performed in the following way: For fusA, leuS and recG, two annealing temperatures are used (60°C during 10 cycles and 50°C during 21 cycles).  For pyrG and rpoB, only one annealing temperature is used ( 55°C during 30 cycles).

- Allele templates

fusA (633 bp)

GGTGTAAACCACAAAATCGGTGAAGTTCATGACGGCGCAGCCACCATGGACTGGATGGAACAGGAACAAGAGCGT
GGTATTACCATCACCTCCGCTGCGACTACTGCATTCTGGTCAGGTATGGCTAAGCAGTATGAACCGCATCGCGTA
AACATCATCGACACCCCAGGACACGTTGACTTCACCATCGAAGTAGAACGTTCTATGCGTGTACTGGACGGTGCA
GTAATGGTTTACTGTGCGGTAGGTGGCGTTCAGCCACAGTCTGAGACCGTATGGCGTCAGGCTAACAAATACAAA
GTACCTCGTATCGCGTTCGTTAACAAAATGGACCGTATGGGTGCTAACTTCCTGAAAGTTGTTGGTCAGATCAAA
ACCCGTCTGGGCGCGAACCCTGTTCCGCTGCAGCTGGCAATTGGTGCTGAAGAAGGCTTCACCGGTGTTATCGAC
CTGGTGAAAATGAAAGCCATCAACTGGAACGATGCAGACCAAGGCGTGACCTTCGAATACGAAGAGATCCCAGCT
GACATGCAGGATCTGGCTGACGAATGGCACCAGAACCTGATCGAATCCGCTGCCGAAGCTTCTGAAGAGCTGATG
GAGAAATACCTGGGTGGTGAAGAACTGACTGAA

leuS(642 bp)

CAGTGGTTCATCAAGATCACTGACTACGCCGATCAGCTGCTGAGCGATCTGGACGGTCTGAACGAATGGCCAGAC
ATGGTGAAAACCATGCAGCGCAACTGGATTGGCCGCTCCGAAGGGGTCGACATCACCTTTGATATCGACGGCATG
GATGACACGCTGACCGTGTACACCACCCGCCCAGATACCTTCATGGGCGTGACCTATGTTGGTATTGCCGCCGGT
CACCCACTGGCGCAAAAAGCCGCTGAGAACAACCCTGAGCTGGCGGCTTTCATCAACGAATGCCGTAACACCAAG
GTGGCCGAAGCTGAGCTGGCGACCATGGAGAAAAAAGGCGTGGCCACCGGCCTGTACGCTATCCACCCACTGAAC
GGCCGCAAGGTGCCAGTATGGGTAGCGAACTTTGTACTGATGGGCTACGGCACCGGCGCAGTCATGGCGGTACCG
GCGCACGATCAGCGCGATTATGAATTTGCCACCAAGTACAGCCTGCCAATTGACGCGGTAATCAAACCGGCTGAC
GGTAGCGAGCTGGATATCTCCGCTCAGGCATACACTGAAAAAGGCATTCTGTTTAACTCTGGTGAGTTCGACGAT
CTGGACTTCGACGGTGCGTTCAATGCCGTCGCTGACAAGCTG

pyrG (306 bp)

ATTCTCGAAGCGCGTGGCCTCAATGTCACCATCATGAAACTGGACCCTTACATCAACGTGGATCCGGGCACCATG
AGCCCAATCCAGCACGGTGAAGTATTCGTAACGGAAGACGGTGCGGAAACAGACCTTGATTTGGGCCACTATGAG
CGTTTTATTCGCACTAAGATGACCCGCCGCAACAACTTCACTACCGGTCGCGTATACGCCGACGTGCTGCGCAAA
GAGCGCCGTGGTGATTACTTAGGGGCGACCATTCAGGTTATTCCGCATATTACTAATGCGATCAAAGAGCGTGTT
ATCGCC

recG (312 bp)

ATCTGCGCCGGTCAGCAAGTAGCCTTGATGGCACCGACCGAGCTATTAGCCGAGCAGCACGCCACCAACTTTCGC
AGCTGGTTTGAGCCGCTAGGCATTCGGGTCGGCTGGCTAGCCGGCAAGCAAAAAGGCAAAGCACGAATCGCGGAG
CAACAAGCGATCGCCGATGGCGAGGCCATGATGGTGGTCGGCACCCACGCGCTGTTCCAGCAAGAAATTCACTTT
GCTCGCTTGGGCCTCATTATCATTGATGAGCAGCACCGCTTCGGGGTGCATCAGCGTCTGACCCTGCGCGAAAAA
GGGGCCAGCAAC

rpoB (501 bp)

ACTCACTACGGTCGTGTGTGTCCAATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCCTTGTCTGTG
TACGCACAGACCAACGAGTATGGTTTCCTGGAAACCCCGTACCGTCGCGTGAAAGACGGCGTGGTGACCGACGAG
ATTCATTACCTGTCTGCTATCGAAGAAGGTAACTACGTTATTGCCCAGGCGAACTCCAACCTGGACGAAGACGGC
CGCTTCGAAGAAGAACTGGTAACGTGCCGTAGCAAAGGCGAATCCAGCCTGTTCAGCAAAGATCAGGTGGACTAC
ATGGACGTTTCGACCCAACAGGTCGTTTCTGTCGGTGCGTCTTTGATCCCATTCCTGGAGCACGATGATGCTAAC
CGCGCCCTGATGGGTGCGAACATGCAACGTCAGGCTGTACCTACTCTGCGTGCTGATAAGCCGCTGGTTGGTACC
GGTATGGAGCGCGCTGTAGCGGTTGACTCCGGTGTAACCGTAGTTGCTAAG

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.