F. valence and J. Berrier


PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Propionibacterium freudenreichii

 

- Genes

The Propionibacterium freudenreichii MLST scheme uses internal fragments of the following seven housekeeping genes:

  • adk (Adenylate kinase)
  • fumC (Fumarate hydratase, class-II)
  • gtf (Polysaccharide synthase)
  • pf1637 (Carboxylic ester hydrolase)
  • pf169 (Carboxylic ester hydrolase)
  • recA (Recombinase A)
  • rpoB (DNA-directed RNA polymerase beta chain)

- Primers for PCR amplification

adk - F3 : GCGATCTCAACCGGAGAC
adk - R3 : GACTTGTAGGCGTCGAGCAG

fumC2 - F : GAACGCCAATGAGGTGATCT
fumC2 - R : GGTCTCGTCGCTGATCTTCT

gtf - F2 : CAGTCGGTGAAGAACCGCTACG
gtf - R1 : CGGCAGGGCATAGGTGAACAAC

pf1637 - F : TTCCCTGGATGCCTATTTCA
pf1637 - R : CGACTCCATGTCGTAGAGCA

pf169 - F : TGATCGAATATCCGGTGCAG
pf169 - R : GATAGCAGGCAAGCGCATAG

recA - F : CAATGAGATCGTGGGAAACC
recA - R : ACCGTAGCCTTACCGGACTT

rpoB2 - F : GAGTTCGGCGAGTACGAGTC
rpoB2 - R : GTGCCGAAGAACTCCTTGAG

- PCR conditions

95C for 3 min

95C for 3 s
58C for 30 s (for rpoB, adK, pf1637, recA, fumC)
59C for 30 s (for pf169)
60C for 30 s (for gtf)
72C for 30 s
(40 cycles)

72C for 10 min

- Sequencing primers

The same primers as for PCR are used.

- Allele templates

adk (303 bp):

CCGCTGGGCAAGCAGGTGGACGCCATCATGAAGGCCGGCGATTTCGTGCCCGACGAGCTCACCGAGCAGATCGTGG CGGATCGACTCGACCAGCCGGACGCCCAGGGTGGCTTCCTGCTCGACGGCTTTCCGCGCACCATGCACCAGGTGGA CGCGCTGGATGACTACCTCGACAAGCATGGCCACTCCCTCGACGCGGTGATCAGCCTGGACGTCGATCCCGAGGAC CTCATCGCGCGCCTGCTCAAGCGGGCCGAGCTCGAGGGTCGCGCCGACGACAATGAGGAGACCATCCGGCACCGC

fumC (345 bp):

ATGGGCACCAAGACCCCGGTGCACCCCAATGACCACGTGAACCGTGGCCAGTCCAGCAACGACACCTTCCCCACGG CGATGCACATTGCCGTGGTCACCGAGCTGCAGGAGATGTACCCGCGCGTGATGAAGCTGCGCGACACCCTGGACGC CAAGGCCAAGGAATATGACGATGTCGTGATGGTGGGGCGCACCCACCTGCAGGACGCGACCCCGATCCGCCTCGGC CAGGTGATCAGCGGCTGGGTGGCCCAGATCGACTTCGCCCTCAAGTGCATCAAGTTCTCCGACGAGCAGGCACGCG AACTCGCCATCGGCGGCACCGCCGTCGGCACCGGCCTGAAC

gtf (234 bp):

GTGAGCAAGCAGGCCTTCGACGCCGCCGGGGGCTTCCCGCTGATGGTGGCCGAGGACCTGTGCTTCTCGCTGGCCG TGCGCGAGCACGGGTACACCACCGTGTTCGCACCCGACGTCACCTGCCAGGAGGAGTTCCCGGTGGACTACCTGGC GTTCCGCAAGCGCCACAGCAAGTGGACGCAGGGGAACATGGAGTTCATCCGCAAGAACACCCGTCCGATCATGACC TCACGC

pf1637 (477 bp):

TACGCCGTCGAGCCCTTGCGCGACGGCCGCAGCTTCTCGTCGCGGCGCGTCACCGCCCTGCAGGACGGCCGCGCCA TCTTCACCATGTCGAGTTCCTTCCACGAGCTGGAGCCGGGCTTCGACCATTCCGATCCCGAACCGCTCGACGTGCC CCCGCCCCAGGAATGTCCTTCCTTCATCGAGACGATCGAGGAACGTTACGGCGATGCCGCGATCTGGCACGAATGG GACGCCCTCGACGTGCGCTACGTGGGGGACAGCACCCCGGGCGGTGGTATGCCGGACGATCCCACGCGCCGAGCGC GCATGCGGGTGTGGGTCAAGACCACGGCGGCCCTGCCCGATGAGATCTCCATCCACCAGGCGATCGTTGCCTATCT GTCAGACCTGACGTTGCTGTCGGTGGCGACGCTGCCACACGGCGTGGCGTTCATGTCGAACCAGTTGCAGATCGCC AGCATCGACCACGTCATGTGG

pf169 (309 bp):

CTGGACGCTCTGGGCGAACTGCGGGGCCTTGATGGCTTCCGTGACCGTCGGCTCGGGGTGGTGGGGTTTTCCGCAG GCGCGCACCTGGCGGGCATGTGTTGCCATCCGGAGGCATTCGGCTTCCGGGTTCCCCGCCCCGATTTCGCCGTCTT CGGCTATCCCCTCATATCGATGGACGCCGACACCCATCGCGGGTCGATGGAGACGCTGTTGGGCCCCGACGCCGAT GACCAGACCCGTCGCACATTCAGTATCGACCGCCTCGTGGATCCGCAGACGCCGCCAAGCTTCGTCTGGCAGACCG ATGAG

recA (312 bp):

GCGCCGCCGTTCAAGCAGGCCGAATTCGACATTCTCTATGGCAAGGGCATCAGTCGTGAGGGAAGCCTCATCGATA TGGGTGTGGACGCCGGGATCGTGCGCAAGGCCGGGGCATGGTTCACCTATGGTGATGACCAGCTCGGGCAGGGCAA GGAGAATGCCCGCACCTTCCTGATCACCCATCCTGAGGTCGCCAGTGATATCGAGCACAAGATCCGGGTGAAGCTC GGGCTGGACGCCAGTGATGAGGTACCTGAGGGGATCGATCCCAGGACCGGGGAGGTCGTGGATTCCCCGGCGAGCG AGCTGGTG

rpoB (429 bp):

ACCACCCAGGACGAGGCCCTGCTCGACATCTACCGCAAGCTGCGTCCGGGCGAGCCCCCGGCGCGCGATGCTGCCCA GACGCTGCTGGACAACTTCTACTTCAACCCGAAGCGCTATGACACCGCCAAGGTTGGCCGCTACAAGATCAACAAGA AGCTCGGCCTGAGCCTGCCCTACGACCAGCAGGTGCTCACGATGGACGACATCGTGGCCGCGATCCACTACATCTGT GCGCTGCACGAGGGCAAGACCGAGCTGGCTGATGGCCTGCCCGTCGAGCCCGATGACATCGACCACTTCGGCAATCG CCGGGTGCGCACGGTGGGCGAGCTGATCCAGAACCAGCTGCGTACCGGCCTGGGCCGCATGGAGCGCGTCGTGCGTG ATCGCATGACCACCCAGGACATCGAGGCCATCACGCCCCAGACC
Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.