PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Pantoea agglomerans

 

- Genes

The Pantoea agglomerans MLST scheme uses internal fragments of the following six housekeeping genes:

  • fusA (protein chain elongation factor EF-G)
  • gyrB (DNA gyrase)
  • leuS (leucyl-tRNA synthetase)
  • pyrG (CTP synthase)
  • rplB (50S ribosomal protein L2)
  • rpoB (RNA polymerase subunit B)

- Primers for PCR amplification

FusA : F : FusA3 : CATCGGCATCGGTATCAGTGCKCACATCGA
FusA : R : FusA4 : CAGCATCGCCTGAACRCCTTTGTT

gyrB : F : gyrB3 : GCGTAAGCGCCCGGGTATGTA
gyrB : R : gyrB4 : CCGTCGACGTCCGCATCGGTCAT

leuS : F : leuS3 : CAGACCGTGCTGGCCAACGARCARGT
leuS : R : leuS4 : CGGCGCGCCCCARTARCGCT

pyrG : F : pyrG3 : GGGGTCGTATCCTCTCTGGGTAAAGG
pyrG : R : pyrG4 : GGAACGGCAGGGATTCGATATCNCCKA

rplB : F : rplB3 : CAGTTGTTGAACGTCTTGAGTACGATCC
rplB : R : rplB4 : CACCACCACCATGYGGGTGRTC

rpoB : F : Vic3 : GGCGAAATGGCWGAGAACCA
rpoB : R : Vic2 : GAGTCTTCGAAGTTGTAACC

- PCR conditions

PCR amplification is performed at two annealing temperatures of 60C during 10 cycles and 50C during 21 cycles for fusA, gyrB, leuS, pyrG and rplB genes, and at an annealing temperatures of 50C for rpoB.

- Sequencing primers

We use the PCR primers also for sequencing, except for gene gyrB for which primers gyrB3i and gyrB4i are used .

gyrB : F : gyrB3i : AACGCWATCGACGAAGC
gyrB : R : gyrB4i : TGGAAVCCRTCRTTCCAC

- Allele templates

fusA(633 bp)

GGTGTAAACCACAAAATCGGTGAAGTACATGACGGCGCAGCAACCATGGACTGGATGGAGCAGGAACAGGAACGTG GTATTACCATCACCTCCGCTGCGACCACCTGTTACTGGTCTGGTATGGCCAAGCAGTTTGAACCACACCACGTAAA CATTATCGACACCCCAGGACACGTTGACTTCACCATCGAAGTTGAACGTTCTATGCGTGTGCTTGATGGCGCGGTA ATGGTTTACTGTGCAGTTGGTGGCGTTCAGCCACAGTCTGAGACCGTATGGCGTCAGGCTAACAAATATAAAGTTC CACGCATTGCGTTCGTTAACAAAATGGACCGCATGGGTGCTAACTTCCTGAAAGTTGTTAAACAGATGGAAGTTCG TCTGGGCGCAACTCCAGTTCCTCTGCAGCTGGCTATCGGCGCAGAAGAGAAATTCACCGGTGTTGTTGACCTGGTG AAAATGAAAGCAATCAACTGGAACGACGCAGACCAGGGTGTAACCTTCGTCTACGAAGATATCCCAGCTGATATGC AGGAACTGGCTGAAGAATGGCATGCGAAGCTGGTTGAAGCCGCTGCTGAAGGCTCTGATGAGCTGATGGAGAAATT CTTCGGTGGTGAAGAACTGACTGAA

gyrB (417 bp)

GAGGGCATTTCTGCCGCTGAAGTGATCATGACCGTGCTGCATGCTGGCGGTAAGTTCGATGATAACTCCTATAAAG TCTCCGGCGGCCTGCACGGCGTGGGCGTCTCCGTGGTTAACGCCCTGTCGCAGAAGCTGGAGCTGACCATTCGTCG CGAAGGCAAAGTGCATCAGCAGATTTACGTCCATGGCGTACCGCAGGCACCACTGGCGGTGACGGGTGAGACCGAC ATTACCGGGACCCGTGTGCGTTTCTGGCCAAGCCACGAAACCTTTACCAACGTGCGCGATTTTGAGTATGACATCC TGGCGAAACGCCTGCGTGAACTCTCATTCCTGAACTCCGGCGTGTCGATTCGTCTGGATGATAAGCGTGATGGTAA AAGTGATCACTTCCACTATGAAGGCGGCATCCGGGCG

leuS (642 bp)

CAGTGGTTTATCAAAATCACCGATTATGCGGAAGAGCTGCTGAACGACCTGGATACGCTGGAAGAGTGGCCTGAGCA GGTCAAAACCATGCAGCGTAACTGGATTGGCCGCTCTGAAGGTGTCGAAATCACCTTCGATGTGGCTGACAGCGAAG AGAAGGTCACTGTCTACACCACCCGCCCGGATACCTTTATCGGCGCAACCTATGTTGCCGTTGCCGCAGGCCATCCG CTGGCGACCCAGGCGTCGGTCAATAATCCGGCGCTGGCTGACTTTATCGCTGAATGTCGCAATACCAAAGTGGCTGA AGCCGATATGGCGACCATGGAGAAGAAAGGCATGGCGACCGGCCTGTCTGTTGTTCATCCGCTGACCGGCGAGCTTA TCCCGGTCTGGGTTGCCAACTTCGTACTGATGGAATATGGCACCGGCGCTGTGATGGCGGTTCCGGCGCACGATCAG CGCGACTGGGAGTTTGCCACTAAATATGATCTGCCGATTAAGCCGGTCATCCTGAATCTGGATGGTTCCATTCCTGA TGTCAGCATTGCGGCGATGACTGACAAAGGTGCGCTGTTCAACTCAGGTGAGTTTAACGGCATGGATCACGCCACCG GTTTTAACGCCATCGCGGATTCGCTG

pyrG (306 bp)

ATTCTCGAAGCCCGTGGTCTGAACGTGACCATCATGAAGCTGGACCCGTATATCAACGTGGATCCAGGCACCATGAG CCCGACGCAGCACGGTGAAGTTTTCGTCACTGATGACGGCGCTGAAACCGATCTGGATTTGGGTCACTACGAGCGCT TCATCCGTACCAAAATGTCGCGTCGTAACAACTTCACCACTGGCCGTATCTACTCAGAAGTCCTGCGCAAAGAGCGC CGTGGCGACTATCTGGGCGCAACCATTCAGGTTATTCCGCACATCACCAACGCCATCAAAGAACGCATTATTGAA

rplB (333 bp)

CGTTACATCCTGGCCCCTAAAGGCCTGAAAGCCGGCGACCAGATCCAATCTGGCGTTGATGCTGCGATTAAAGCAGG TAACACTCTGCCGATGCGTAACATCCCGGTGGGTTCAACCGTGCATAACGTAGAAATGAAACCAGGCAAAGGCGGTC AGATTGCTCGCTCAGCCGGTGCTTACGTGCAGATCGTTGCGCGTGAAGGTTCTTACGTTACCCTGCGTCTGCGTTCA GGTGAAATGCGTAAAGTCGAGTCTGACTGCCGCGCAACACTGGGCGAAGTCGGCAACGCTGAGCATATGCTGCGCGT TCTGGGTAAAGCTGGTGCAGCCCGT

rpoB (501 bp)

ACGCACTACGGTCGTGTCTGCCCAATCGAAACCCCTGAAGGCCCGAACATCGGTCTGATCAACTCCTTGTCTGTGTAT GCACAGACCAACGAGTACGGTTTCCTTGAGACGCCTTACCGCCGTGTTATCGACGGTCTGGTTTCTGACGAGATTCAC TACCTCTCTGCTATCGAAGAGGGTAACTACGTTATCGCTCAGGCGAACGCCCCTCTTGATGATAACGGCGCGTTTGTT GATGACCTGGTCACCTGCCGTAGCAAAGGCGAATCAAGTCTGTTCAGCCGCGATCAGGTTGACTACATGGACGTTTCG ACTCAACAGATCGTTTCTGTCGGTGCGTCACTGATCCCGTTCCTGGAACACGATGATGCTAACCGCGCCCTGATGGGT GCGAACATGCAACGTCAGGCCGTTCCGACTCTGCGTGCTGATAAGCCGCTGGTTGGTACGGGTATGGAACGTGCTGTT GCCGTTGACTCCGGTGTAACTGCCGTTGCCAAA

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.