PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Listeria monocytogenes

 

- Genes

The Listeria monocytogenes MLST scheme uses internal fragments of the following seven housekeeping genes:

  • abcZ (ABC transporter)
  • bglA (beta glucosidase)
  • cat (catalase)
  • dapE (succinyl diaminopimelate desuccinylase)
  • dat (D-amino acid aminotransferase)
  • ldh (L-lactate dehydrogenase)
  • lhkA (histidine kinase)

- PCR amplification

Protocol uses primers with universal sequencing tails to sequence all genes with the same forward and reverse sequencing primers.

abcZoF : GTTTTCCCAGTCACGACGTTGTATCGCTGCTGCCACTTTTATCCA
abcZoR : TTGTGAGCGGATAACAATTTCTCAAGGTCGCCGTTTAGAG

bglAoF : GTTTTCCCAGTCACGACGTTGTAGCCGACTTTTTATGGGGTGGAG
bglAoR : TTGTGAGCGGATAACAATTTCCGATTAAATACGGTGCGGACATA

catoF : GTTTTCCCAGTCACGACGTTGTAATTGGCGCATTTTGATAGAGA
catoR : TTGTGAGCGGATAACAATTTCAGATTGACGATTCCTGCTTTTG

dapEoF : GTTTTCCCAGTCACGACGTTGTACGACTAATGGGCATGAAGAACAAG
dapEoR : TTGTGAGCGGATAACAATTTCATCGAACTATGGGCATTTTTACC

datoF : GTTTTCCCAGTCACGACGTTGTAGAAAGAGAAGATGCCACAGTTGA
datoR : TTGTGAGCGGATAACAATTTCTGCGTCCATAATACACCATCTTT

ldhoF : GTTTTCCCAGTCACGACGTTGTAGTATGATTGACATAGATAAAGA
ldhoR : TTGTGAGCGGATAACAATTTCTATAAATGTCGTTCATACCAT

lhkAoF : GTTTTCCCAGTCACGACGTTGTAAGAATGCCAACGACGAAACC
lhkAoR : TTGTGAGCGGATAACAATTTCTGGGAAACATCAGCAATAAAC

For strains of lineage 3, we use the following primers in case of failure with the above primers:

lhkA-F3 : GCAAGTTTTGAATACGTATCAGCG
lhkA-R2 : TACGCATTTCATGAGAAACATCAG

- Universal sequencing primers

oF : GTT TTC CCA GTC ACG ACG TTG TA
oR : TTG TGA GCG GAT AAC AAT TTC

- PCR conditions

  • 94° for 4 min
  • 94° for 30 s
  • 52° for 30 s* (35 cycles)
  • 72° for 2 min
  • 72° for 10 min

    *PCR amplification is performed at an annealing temperature of 52°C for all genes except for bglA (45°C).

  • - Allele templates

    abcZ(537 bp)

    AAATCGACGAACAGAATGCGTATAGGACTTTTCCGCAAGATGGAAAAACTATCAATCCGTTTCTTCGATAGTCGCAATGATGG
    CGAAATGCTTAGTCGTTTCACTAGTGACTTAGATAATATTTCCAACACACTAAACCAAGCATTGATCCAAGTACTATCCAACG
    TCGCGCTAATGATTGGTGTTATCATCATGATGTTCCAACAAAACGTGGAACTAGCCTTCGTTACTCTAATATCTGCTCCATTT
    GCGATTATTATTGCGACAGTGATTATTCGAAAAGCCCGCAAATTCGTTGATATTCAACAAGATGAACTAGGCGTACTTAACGG
    CTACATTGACGAAAAAATCTCTGGTCAAAAAATTATTATCACAAATGGCTTAGAAGAAGAAACAATTGACGGCTTTGTTAAAC
    AAAACAATATCGTTAAAAACGCAACTTACAAAGGTCAAGTTTACTCCGGTTTACTTTTCCCAATGATGCAAGGTATTTCCCTA
    TTAAATACAGCTATTGTTATCTTCTTCGGTGGATGGTTA

    bglA (399 bp)

    AACCAATTCGAAGGCGCTTACAACGTCGATGGAAAAGGACTTTCCGTTCAAGATGTTACTCCAAAAGGCGGATTTGGTCACAT
    TACTGACGGTCCAACACCAGATAACTTAAAATTAGAAGGAATTGACTTCTATCATCGCTACAAAGATGACGTGAAACTTTTTG
    CCGAAATGGGCTTCAAGGTTTTCCGTACTTCCATCGCTTGGTCCCGTATCTTCCCAAATGGTGACGAAACTGAGCCAAACGAA
    GCAGGATTACAATTTTACGATGATTTATTCGATGAACTTCTAGCACATAATATCGAACCACTGATTACTTTATCTCACTATGA
    AACACCACTTCACTTATCGAAAACTTACGACGGCTGGGTAAATAGAAAAATGATCGACTTCTATGAA

    cat (486 bp)

    GCTCGTGGTGCTGGTGCTCACGGGAAATTTGTCACTAAGAAAAGCATGAAAAAATATACAATGGCTAAATTTTTGCAAGAAGA
    AGGAACGGAAACGGAGGTTTTTGCTCGTTTTTCAACAGTAATTCATGGGCAACATTCTCCAGAAACATTACGTGATCCACGCG
    GTTTCTCCGTTAAGTTTTATACAGAAGAAGGGAATTATGATTTTGTCGGAAATAATTTGCCGGTATTCTTCATTCGTGATGCG
    ATTAAGTTTCCGGATGTTATTCATTCCTTGAAGCCTGATCCACGCACAAATATTCAAGATGGCAACCGTTACTGGGATTTCTT
    TAGCCTTACACCGGAAGCTACGACGATGATTATGTACTTATTCAGTGATGAAGGAACGCCGGCTTCTTACCGGGAAATACGTG
    GCTCTAGTGTTCATGCGTTCAAATGGATTAATGAAGAAGGCAAAACAGTTTATGTAAAACTGCGCTGGATT

    dapE (462 bp)

    TTGCAAAAGTTGTTAGCTGAACACGGTATTGAGTCCGAAAAGGTAAAATACGACGTAGACAGAGCCAGCCTAGTTAGCGAAAT
    TGGTTCCAGTGACGAGAAAGTTTTGGCGTTTTCAGGGCATATGGATGTCGTTGATGCGGGTGATGTCTCGAAGTGGAAGTTCC
    CACCTTTTGAAGCAACAGAGCATGAAGGGAAAATATACGGACGTGGCGCGACGGATATGAAGTCAGGTCTAGCGGCGATGATT
    ATTGCAATGATTGAGCTTCATGAAGAAAAACAAAAACTAAATGGCAAAATTAGATTATTAGCAACGGTTGGTGAAGAAGTCGG
    TGAACTTGGAGCCGAACAACTAACGCAAAAAGGTTACGCAGATGATTTAGATGGCTTGATTATCGGCGAACCGAGTGGACACC
    GGATTGTTTATGCGCATAAAGGTTCCATTAATTATACCGTTAAATCC

    dat (471 bp)

    GAAGTAGTTCGTCTATATAATGGAAAATTCTTCACTTATAATGAACACATTGATCGTTTATATGCGAGTGCAGCAAAAATTGA
    CTTAGTTATTCCTTATTCTAAAGAAGAGTTACGAGCGTTACTTGAAAAATTAGTTGCTGAAAATAATATTAATACAGGAAATG
    TCTATTTACAAGTGACTCGAGGTGTTCAAAACCCGCGTAATCACGTTATGCCAGATGATTTCCCGCTGGAAGGCGTTTTAACA
    GCAGCAGCTCGTGAAGTACCAAGAAATGAACAACAATTTGTGCAAGGTGGACCAGTAATTACAGAAGAAGATGTTCGTTGGTT
    ACGCTGTGACATCAAGAGTTTGAATTTACTTGGAAACATTTTAGCAAAAAACAAAGCACATCAACAAAATGCGTTAGAAGCTG
    TTTTACACCGCGGAGAGCAAGTAACTGAGTGTTCAGCTTCCAATATTTCTATTATT

    ldh (453 bp)

    TATAGCGACTGCCACGATGCGGACTTAGTTGTTGTAACTGCCGGGACTGCACAAAAACCTGGTGAAACTCGTTTAGATTTAGT
    AAATCGTAATATTAAAATCATGAAAGGCATCGTGGATGAAGTAATGGCTAGCGGATTTGACGGTATCTTCTTAATCGCTTCTA
    ACCCAGTAGATATCTTAACTTACGCTACATGGAAATTCTCAGGTCTTCCAAAAGAACGTGTTATCGGTTCTGGAACAAGCCTT
    GATACAGCACGTTTCCGTATGTCAATTGCCGACTATCTAAAAGTAGATGCTCGTAACGTCCATGGTTACATCCTTGGCGAACA
    CGGCGATACAGAATTCCCAGCATGGAGCCACACAACTGTCGGCGGTCTTCCAATCACTGAATGGATTAGCGAAGATGAACAAG
    GTGCAATGGATACTATTTTCGTAAGTGTTCGTGATGCA

    lhkA (480 bp)

    TATCCAACACAGATGAATCAGCCGTTACCAAAGGATTTCTCTATTTCTTCGGATGATAAGAAAAAACTTGAAAGTGGCGAAAC
    AGTTAGTAAGAAAATAGATAATCGCTTTAATAAAGAAATGACAATTGTGTACGTCCCAATAATGAATGGCGACAAATTTGTCG
    GTTCTATCGTGCTCAATTCACCTATTAGCGGTACGGAGCAAGTAATTGGTACGATTAACCGCTATATGTTCTACACTATTTTA
    CTTTCTATAACGGTAGCACTTATTCTTAGCGCAATCTTGTCCAAACTACAAGTAAATCGAATCAACAAACTACGAGCAGCGAC
    AAAAGACGTTATTCAAGGCAATTACAAAGCTCGATTGAAGGAAAATAATTTTGATGAAATTGGTGCACTTGCCATTGATTTCA
    ATAAAATGACACAAACCCTTGAAACATCTCAAGAAGAAATAGAACGACAAGAGAAGCGGAGACGC

    Portail Institut Pasteur Accueil Debut de Page
     
    Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

    This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.