PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Lactobacillus casei

 

- Genes

The Lactobacillus casei MLST scheme uses internal fragments of the following seven housekeeping genes:

  • fusA (protein elongation factor EF-2)
  • ileS (isoleucyl-tRNA synthetase)
  • lepA (GTP-binding protein LepA)
  • leuS (leucyl-tRNA synthetase)
  • pyrG (CTP synthetase)
  • recA (recombinase A)
  • recG (ATP-dependent DNA helicase)

- Primers for PCR amplification

fusA:F:fusAF CCGTAATATCGGGATCATGGCTCACATCGA
fusA:R:fusAR CAACAACATCTGAACACCCTTGTT

ileS:F:ileSF TCCTGGTTGGGATACTCACGG
ileS:R:ileSR AGGAACCGGAATCGAACCACACATC

lepA:F:lepAF CATCGCCCACATTGATCACGGGAA
lepA:R:lepAR CATATGCAGCAAGCCTAAGAACCC

leuS:F:leuSF GGGACGGTTGTTGCAAACGAAGAAGT
leuS:R:leuSR CGGTTCACCCCAATAACGCT

pyrG:F:pyrGF GGGGTCGTATCGTCATTGGGTAAAGG
pyrG:R:pyrGR GGAATGGCAATGATTCGATATCGCCAA

recA:F:recAF CCGGAAAGTTCCGGCAAAACAAC
recA:R:recAR CGCGACCACCTGGTGTCGTTTC

recG:F:recGF AGGCGATGTTGGGAGCGGTAAAAC
recG:R:recGR GTGTTCGGGGAATAGGCGTCGC

- Sequencing primers

The same primers as for PCR are used.

- PCR conditions

*PCR amplification is performed at an annealing temperature of 50 C for all genes.

- Allele templates

fusA(663 bp)

TTGTATTATACCGGTAAAATTCATAAAATCGGTGAAACTCATGAAGGAGCTTCACAGATGGACTGGATGCCACAGG
AACAGGAACGTGGGATCACCATCACCAGTGCTGCTACTACGGCTTTCTGGAAGGATCACCGGGTCAATATCATTGA
CACCCCGGGACACGTGGACTTCACGATTGAAGTTGAACGTTCCCTGCGTGTGCTGGATGGTGCGATCACCGTTTTG
GATGCCCAATCCGGTGTTGAGCCGCAGACCGAAAACGTTTGGCGTCAAGCAACGACATACGGCGTTCCGCGGTTGG
TTTTCGTCAACAAAATGGATAAGATCGGTGCCGACTTCGATTATTCGATGACGACATTGCATGATCGGCTTCAGGCT
AACGCTCACGCCGTTCAGATGCCGATCGGTGCCGAAGATAAGTTCGAAGGGGTCATTGACCTGATCGAAATGAAG
GCCGATTTGTATGACGAAGATGAATTGGGTACCAAGTGGGACACTGTAGATGTTCCGGATGACTACAAGGAAGCT
GCTCAAAAAGCGCATAACGACTTGATCGAAGCCGTTGCTGACGTTGACGACGGCATCATGGACAAGTACCTTGAA
GGTGAAGAGATTTCCAATGCTGAATTGAAGGCTGCGATCCGTAAAGCAACCATCAAC

ileS (360 bp)

TGGACCATTCCGGCTAACTATGGGATTACGGTTAATCCGCGGTTCGATTACGTTCAGGTTCAAGTTGGCGACAAAA
AGTACGTGGTTGCTGCCGAATTACTTGATCGCGTAGCTGAAGAAATTGGCTGGGAAAATCCGAAGATCCTGAAAAC
CTTTAAGGGCACGGATATGGATAAAATGACTGCTCAGCATCCTTTATATGATCGCACGAGTCTTGTCATGAATGCT
GATCATGTCACGTTGGATGCTGGGACTGGACTTGTCCATACAGCGCCTGGTCATGGGGAAGATGACTACAAAGTCG
GGGTTAAATACGGCTTGCCTGTCGTCTCAGTAGTTGATGCCAAAGGTTACATGAAT

lepA (549 bp)

GACTTCAGCTATGAAGTCAGCCGCAGTCTGGCGGCCTGTGAAGGGGCCTTGCTGGTCGTGGATGCCACCCAAGGCG
TCGAAGCCCAGACATTAGCCAACGTCTATTTAGCGATCGATGATGACCTTGAAATCATCCCGGTCATTAACAAGGT
TGATTTACCGAGTGCCCAGCCAGATGTCGTTAAAGAGGAAATTGAAGAGATGATCGGGCTGGATGCCTCCGATGCT
ATTTTGGCCAGTGGTAAAACCGGCCTAGGCGTGCCTGAAATTCTTGAGCGGATTGTGACCGATGTGCCAGCACCAT
CTGGCGATTTGAATGCGCCATTACAAGCACTGATTTTTGACTCGGTTTATGACGATTACCGTGGCGTTGTGCTTGAT
GTGCGCGTCAAGGAAGGCCAAGTTAAAGTCGGCGACACCATTCAGCTGATGAGCAATGGCAAGCAATTTCAAGTG
ACCGAAGTCGGCGTGATGTCGCCTAAAGCGGTCAAACGTGATTTTCTAATGGTCGGAGATGTTGGCTATATCACAG
CTGCGATCAAAACCATT

leuS (642 bp)

GTTCGGAAGCCGATGCGTCAGTGGATGCTGAAAATCACAGCCTATGCTGAAAAGCTGTTGACGGATCTGGACGATC
TTGACTGGCCGGAATCAATTAAGCAGATGCAACGCAACTGGATTGGCAAATCAACTGGGGCACAGATCACCTTCCG
GGTAACTGACAGTCATGAGCCGTTTGATGTCTTTACCACTCGTCCAGATACGCTGTTTGGTGCAACGTATGTCGTGA
TGGCACCAGAACATGAATTAGTTCAGAAAATTACCACCCCGGCACAACAGGCAGTCGTTGATGCGTACATTGACGA
AGCCGCCCATAAGTCAGATCTTGATCGTACCGCTTTAGATAAGGAAAAGACTGGTGTTTGGACCGGGGCCTACGCG
ACTAATCCGGTTAACGGCGAAAAACTGCCGATTTGGATTTCAGACTACGTTTTAGCCTCTTATGGGACTGGCGCAA
TCATGTCCGTGCCTGCGCATGATGATCGTGACTACGCTTTTGCCAAAAAGTTTGGTATTGAAATCAAGCCTGTTATT
GAAGGCGGCAATGTCGATGAAGCAGCTTATACTGGCGATGGCGTGCACATCAACTCCGGGTTCCTTGATGGTTTGA
ATGAACACGACGCGATTGATCGAATGATCAAA

pyrG (345 bp)

TTAGGTCGTTTGTTAAAGAATCGCGGTTTGAAGATCACCATTCAAAAATTCGACCCTTATATCAATGTCGATCCTGG
GACGATGAACCCTTATCAACATGGTGAAGTGTTCGTTACCGACGATGGCGCGGAGACCGACCTCGACCTTGGCCAT
TATGAACGGTTTATTGACATCAACCTGAATAAGTACAGCAACGTCACAACCGGGAAAATTTATTCTGAAGTTCTGC
AACGTGAACGCCGCGGTGAATACCTCGGTGCGACCGTTCAAGTGATCCCCCACATTACCAACATGATCAAAGAGA
AGATCATGCGGGCCGCAAAGCATAGCGACTCCGATGTGATT

recA (315 bp)

ACTGCCGCCTATATTGATGCCGAGAATGCGATGGATCCCAAGTACGCAACTGCTTTGGGCGTCAATATTGACGAAT
TATTGCTCTCCCAGCCAGACACAGGCGAACAAGGGCTGGAGATTGCTGATGAACTAGTCGCGTCTGGTGCCATTGA
TATTGTGGTGATTGATTCAGTTGCTGCTTTGGTGCCGCGGGCTGAGATTGAGGGCGATATGGGGGATGCCCATGTT
GGCTTGCAAGCCCGATTAATGTCACAGGCGTTACGTAAGTTATCCGGTTCCATCAATAAGACAAAAACGATTGCTT
TATTCATTAAT

recG (342 bp)

GTTGCCGCCATTGTTCTGTATGCGGCGGTGACCGCTGGTTTTCAGGCGGCTTTAATGGTGCCGACTGAAGTGTTAGC
TGAGCAACATTTTGCCAAATTGACAAAGTTATTCAAAGATTTTCCAGTCAAATTAGGGTTGTTGACTGGCTCGACGT
CAACCAAAAAGCGTCGCGAGCTCCTAAGTGAGTTGCGTGATGGCCGCCTGAATCTCATCATCGGCACGCACGCGTT
GATTCAAAAAGGGGTCGACTTTCATGCGCTCGGTCTGGTTGTTATTGATGAACAGCATCGATTTGGGGTTAATCAG
CGCAAGATCCTTCAAGAAAAAGGACAAAAGCCGGAT

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.