PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Klebsiella pneumoniae

 

- Genes

The Klebsiella pneumoniae MLST scheme uses internal fragments of the following seven housekeeping genes:

  • rpoB (beta-subunit of RNA polymerase)
  • gapA (glyceraldehyde 3-phosphate dehydrogenase)
  • mdh (malate dehydrogenase)
  • pgi (phosphoglucose isomerase)
  • phoE (phosphorine E)
  • infB (translation initiation factor 2)
  • tonB (periplasmic energy transducer)

- PCR amplification and Sequencing

Two protocols are available. Protocol 1 (P1) uses the original primers and conditions of our publication (Diancourt et al., 2005); Protocol 2 (P2) is a simplified protocol that uses primers with universal sequencing tails, which allows to PCR all genes at the same temperature and to sequence all genes with the same forward and reverse sequencing primers.


Protocol 1 (Diancourt et al., 2005) :

- Primers for PCR amplification (P1)

rpoB : F : Vic3 : GGCGAAATGGCWGAGAACCA
rpoB : R : Vic2 : GAGTCTTCGAAGTTGTAACC

gapA : F : 173 : TGAAATATGACTCCACTCACGG
gapA : R : 181 : CTTCAGAAGCGGCTTTGATGGCTT

mdh : F : 130 : CCCAACTCGCTTCAGGTTCAG
mdh : R : 867 : CCGTTTTTCCCCAGCAGCAG

pgi : F : 1R : GAGAAAAACCTGCCTGTACTGCTGGC
pgi : R : 1F : CGCGCCACGCTTTATAGCGGTTAAT

phoE : F : 604.1 : ACCTACCGCAACACCGACTTCTTCGG
phoE : R : 604.2 : TGATCAGAACTGGTAGGTGAT

infB : 1F : CTCGCTGCTGGACTATATTCG
infB : 1R : CGCTTTCAGCTCAAGAACTTC

tonB : 1F : CTTTATACCTCGGTACATCAGGTT
tonB : 2R : ATTCGCCGGCTGRGCRGAGAG

- PCR conditions (P1)

PCR amplification is performed at an annealing temperature of 50°C for all genes except for gapA (60°C) and tonB (45°C)

Note : In the case of gene tonB, with the primers described in Diancourt et al. (2005), you must use MgCl2 at 50 mM. However, the new tonB primers (P2) work with MgCl2 at 25 mM as for other genes, and at the same temperature (50 degrees). .

- Sequencing primers (P1)

We use the PCR primers also for sequencing, except for gene infB for which primer infB2F is used instead of the forward PCR primer, and for pgi, for which primers pgi2F and pgi2R are used.

infB : 2F : ACTAAGGTTGCCTCCGGCGAAGC
pgi : 2F : CTGCTGGCGCTGATCGGCAT
pgi : 2R : TTATAGCGGTTAATCAGGCCGT


Protocol 2 (with universal sequencing primers):

- Primers for PCR amplification (P2)

rpoB : F : Vic3 : oF : GTTTTCCCAGTCACGACGTTGTAGGCGAAATGGCWGAGAACCA
rpoB : R : Vic2 : oR : TTGTGAGCGGATAACAATTTCGAGTCTTCGAAGTTGTAACC

gapA : F : 173 : oF : GTTTTCCCAGTCACGACGTTGTATGAAATATGACTCCACTCACGG
gapA : R : 181 : oR : TTGTGAGCGGATAACAATTTCCTTCAGAAGCGGCTTTGATGGCTT

mdh : F : 130 : oF : GTTTTCCCAGTCACGACGTTGTACCCAACTCGCTTCAGGTTCAG
mdh : R : 867 : oR : TTGTGAGCGGATAACAATTTCCCGTTTTTCCCCAGCAGCAG

pgi : F : 1R : oF : GTTTTCCCAGTCACGACGTTGTAGAGAAAAACCTGCCTGTACTGCTGGC
pgi : R : 1F : oR : TTGTGAGCGGATAACAATTTCCGCGCCACGCTTTATAGCGGTTAAT

phoE : F : 604.1 : oF : GTTTTCCCAGTCACGACGTTGTAACCTACCGCAACACCGACTTCTTCGG
phoE : R : 604.2 : oR : TTGTGAGCGGATAACAATTTCTGATCAGAACTGGTAGGTGAT

infB : 1F : oF : GTTTTCCCAGTCACGACGTTGTACTCGCTGCTGGACTATATTCG
infB : 1R : oR : TTGTGAGCGGATAACAATTTCCGCTTTCAGCTCAAGAACTTC

tonB : 1F : oF : GTTTTCCCAGTCACGACGTTGTACTTTATACCTCGGTACATCAGGTT
tonB : 2R : oR : TTGTGAGCGGATAACAATTTCATTCGCCGGCTGRGCRGAGAG

- PCR conditions (P2)

PCR amplification is performed at an annealing temperature of 50C for all genes.

- Sequencing primers (P2)

Universal sequencing primers

Forward strand : primer oF : GTTTTCCCAGTCACGACGTTGTA
Reverse strand : primer oR : TTGTGAGCGGATAACAATTTC


- Allele templates

rpoB (501 bp):

ACCCACTACGGTCGCGTATGTCCGATCGAAACGCCTGAAGGTCCGAACATCGGTCTGATTAACTCCCTGTCCGTGT ACGCGCAGACCAACGAATATGGCTTCCTTGAGACGCCGTATCGTAAAGTGACCAACGGTGTGGTTACTGACGAAAT TCACTACCTGTCTGCTATCGAAGAAGGCAACTACGTTATCGCTCAGGCGAACTCCAACCTGGATGAAAACGGCCAC TTCGTAGAAGATCTGGTTACCTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAGGTTGACTACATGG ACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCGTTCCTGGAACACGATGACGCCAACCGTGC ATTGATGGGTGCGAACATGCAACGTCAGGCGGTTCCGACTCTGCGCGCTGATAAGCCGCTGGTTGGTACCGGTATG GAACGTGCTGTTGCCGTTGACTCCGGTGTTACTGCCGTGGCTAAA

gapA (450 bp):

AACCTGAAGTGGGACGAAGTTGGTGTTGACGTTGTTGCTGAAGCAACCGGTATCTTCCTGACCGACGAAACCGCTC GTAAACACATCACCGCTGGCGCGAAAAAAGTCGTTCTGACTGGCCCGTCCAAAGACAACACTCCGATGTTCGTTCG CGGCGCTAACTTCGACGCTTACGCAGGCCAGGACATCGTTTCCAACGCTTCCTGCACCACCAACTGCCTGGCGCCG CTGGCTAAAGTTATCAACGACAACTTCGGTATCGTTGAAGGCCTGATGACCACCGTCCACGCTACCACCGCTACTC AGAAAACCGTTGATGGCCCGTCTCACAAAGACTGGCGCGGCGGCCGCGGCGCAGCTCAGAACATCATCCCGTCCTC TACCGGCGCTGCTAAAGCAGTAGGTAAAGTACTGCCAGAACTGAACGGCAAACTGACCGGTATGGCGTTC

mdh (477 bp):

GGCGCGGATGTAGTGCTGATCTCCGCGGGCGTGGCGCGTAAGCCCGGCATGGATCGTTCCGACCTGTTTAATGTGA ATGCGGGTATCGTGAAGAACCTCGTGCAGCAGATTGCCAAAACCTGCCCGCAGGCCTGCATCGGCATTATCACCAA CCCGGTGAATACCACCGTGGCTATCGCCGCCGAAGTACTGAAAAAAGCCGGCGTGTACGATAAAAACAAACTGTTC GGCGTTACCACGCTGGACATCATCCGTTCCAATACCTTTGTGGCGGAGCTGAAAGGTAAATCGGCAACCGAGGTGG AAGTCCCGGTCATTGGTGGTCACTCCGGGGTCACCATTCTGCCTTTACTGTCGCAGATCCCCGGCGTCAGCTTTAG CGATCAGGAAATTGCCGACCTGACTAAACGTATTCAGAACGCCGGTACCGAAGTCGTGGAAGCGAAAGCGGGCGGC GGGTCGGCGACCTTGTCGATG

pgi (432 bp):

GAGTCCAACGGTAAGTATGTTGACCGTAACGGCCACGCGGTAGACTACCAGACTGGCCCAATCATCTGGGGTGAGC CGGGCACCAACGGTCAGCACGCGTTCTACCAGCTGATCCACCAGGGCACCAAAATGGTACCGTGCGATTTCATCGC TCCGGCTATCACCCACAACCCGCTGTCTGACCACCATCAGAAACTGCTGTCTAACTTCTTCGCCCAGACCGAGGCC CTGGCCTTTGGTAAATCCCGCGAAGTGGTTGAGCAGGAATATCGCGATCAGGGTAAAGACCCGGCGACCCTGGAGC ACGTGGTGCCGTTCAAAGTGTTCGAAGGTAACCGCCCGACTAACTCCATCCTGCTGCGTGAGATCACCCCGTTCAG CCTCGGGGCGCTGATTGCCCTGTACGAGCACAAAATCTTCACCCAGGGCGCG

phoE (420 bp):

GTCGGCACCTCGTTAAGCTATGATTTCGGCGGCAGCGACTTCGCCGTCAGCGCAGCCTACACCAGCTCCGACCGTA CCAACGATCAGAACCTGCTGGCCCGCGGCCAGGGTTCGAAAGCGGAAGCCTGGGCGACCGGCCTGAAATATGACGC CAACAATATCTACCTGGCGACCATGTACTCTGAAACCCGCAAGATGACCCCGATCAGCGGCGGCTTTGCCAACAAA GCGCAGAACTTTGAAGCGGTGGCGCAGTATCAGTTCGACTTCGGTCTGCGTCCGTCCCTCGGCTATGTGCTGTCGA AAGGGAAGGATATCGAAGGGGTGGGGAGTGAAGATCTGGTTAACTACATCGACGTGGGCCTGACCTACTACTTCAA CAAAAACATGAACGCCTTCGTGGATTACAAAATCAACCAG

infB (318 bp):

GGCATGATCACCTTCCTGGATACCCCGGGCCACGCCGCGTTTACCTCCATGCGTGCTCGTGGCGCGCAGGCGACGGAT ATCGTGGTTCTGGTGGTGGCGGCAGACGACGGCGTGATGCCGCAGACTATCGAAGCTATCCAGCACGCTAAAGCGGCG CAGGTACCGGTGGTAGTGGCGGTGAACAAGATCGATAAGCCAGAAGCCGATCCGGATCGCGTGAAGAACGAACTGTCC CAGTACGGCATCCTGCCGGAAGAGTGGGGCGGCGAGAGCCAGTTCGTCCACGTTTCCGCGAAAGCGGGTACCGGCATC GACGAC

tonB (414 bp, except some variants with a few codons deleted to inserted):

ATGGTGGCGCCGGCCGATCTTGAGCCGCCTCCGGCGGCGCAGCCTGTCGTGGAGCCCGTTGTTGAACCCGAACCTGAG CCGGAGCCAGAGGTAGTGCCTGAACCGCCGAAAGAGGCGCCGGTGGTGATCCATAAACCGGAACCTAAGCCGAAGCCC AAACCTAAACCCAAGCCTAAGCCGGAGAAAAAGGTTGAACAGCCGAAGCGGGAAGTGAAGCCGGCAGCAGAGCCGCGT CCGGCCTCGCCGTTTGAAAACAACAATACGGCGCCGGCGCGTACAGCGCCAAGCACCTCGACAGCAGCGGCTAAACCC ACCGTTACTGCTCCAAGCGGCCCGCGGGCGATCAGCCGCGTTCAGCCGTCCTATCCAGCGCGCGCTCAGGCGCTGCGC ATTGAAGGTACGGTACGGGTGAAG

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.