PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Flavobacterium psychrophilum

 

- Genes

The Flavobacterium psychrophilum MLST scheme uses internal fragments of the following seven housekeeping genes:

  • atpA (ATP synthetase alpha subunit)
  • dnaK (Chaperone protein DnaK)
  • fumC (Fumarate hydratase class II)
  • gyrB (Dna gyrase B)
  • murG (Glycosyltransferase MurG)
  • trpB (Tryptphane synthetase, beta subunit)
  • tuf (Elongation factor Tu)

- Primers for PCR amplification

atpA-F : CTTGAAGAAGATAATGTGGG
atpA-R : TGTTCCAGCTACTTTTTTCAT

dnaK-F : AAGGTGGAGAAATTAAAGTAGG
dnaK-R : CCACCCATAGTTTCGATACC

fumC-F : CCAGCAAACAAATACTGGGG
fumC-R : GGTTTACTTTTCCTGGCATGAT

gyrB-F : GTTGTAATGACTAAAATTGGTG
gyrB-R : CAATATCGGCATCACACAT

murG-F : TGGCGGTACAGGAGGACATAT
murG-R : GCATTCTTGGTTTGATGGTCTTC

trpB-F : AAGATTATGTAGGCCGCCC
trpB-R : TGATAGATTGATGACTACAATATC

tuf-F : GAAGAAAAAGAAAGAGGTATTAC
tuf-R : CACCTTCACGGATAGCGAA

- Sequencing primers

The same primers as for PCR are used.

- PCR conditions

94°C for 3 min

94°C for 30 s
52°C for 30 s
72°C for 2 min
(35 cycles)

72°C for 8 min

- Allele templates

atpA(978 bp)

GTGGTACTTTTAGGAGCATCTACAGGAATCAAAGAAGGATCTACAGCAAAAAGAACACAA CGTATTGCTTCTCTTAAAGTTGGAGAGCAAATGGTAGGACGTGTAGTAAACACACTTGGT TTTCCTATCGACGGTAAAGGACCAATTGGTGGAGATTTATACGAAATGCCTTTAGAAAGA AAAGCTCCTGGAGTTATCTTCCGTCAACCAGTTACTGAGCCATTACAAACAGGTATCAAA GCAGTAGATGCAATGATCCCAGTAGGTCGTGGACAACGTGAGTTGGTTATTGGTGACCGT CAAACAGGTAAATCTACCGTTTGTATTGACACTATCTTAAATCAAAAAGAATTTTACGAT GCAGGAAAACCTGTATTTTGTATATATGTTGCAATTGGGCAAAAAGCATCAACTGTAGCA GGAATTGCAAAAATGTTAGAAGAAAAAGGCGCAATGGCTTACACGGTTATTGTTGCTGCA AATGCTTCTGATCCAGCACCAATGCAAGTTTACGCGCCAATGGCTGGAGCTGCAATTGGA GAATATTTTAGAGATTCTGGTCGTCCAGCACTTATTGTTTATGATGATTTATCTAAACAA GCAGTTGCTTACCGTGAGGTTTCTCTTTTATTAAGAAGACCACCAGGACGTGAGGCATAT CCTGGAGACGTTTTTTACCTACACTCTCGTTTGTTAGAAAGAGCTTGTAAAGTAATTGCT GATGATGACATCGCAAAAAACATGAACGATTTACCAGATTCATTAAAATCTATCGTAAAA GGTGGTGGTTCATTAACGGCGTTACCAATTATCGAAACACAAGCGGGTGACGTTTCTGCA TATATTCCAACAAATGTAATTTCGATTACCGATGGTCAGATTTTCCTTGATGGAGATTTG TTTAACTCAGGAGTTCGTCCAGCGATTAACGTAGGTATTTCGGTATCTCGTGTTGGAGGA AATGCTCAGATTAAATCG

dnaK (897 bp)

TCTATTAAACGTTTTATGGGGCATTCTTTTTCTGAAACTACAGACGAAGCAAAAAGAGTT CCATATTCAGTTGTAAAAGGAGATAACAATACACCACGTGTGGATATTGATGGTCGTTTA TATACTGCACAAGAATTGTCAGCTATGACACTTCAAAAAATGAAAAAAACAGCTGAAGAC TATTTAGGTCAAACAGTTACAGAAGCAGTTATTACTGTTCCTGCTTACTTTAACGATGCA CAACGTCAAGCTACAAAAGAAGCTGGAGAAATTGCAGGTCTTAAAGTAATGAGAATTATA AATGAGCCTACTGCTGCGGCATTAGCTTACGGATTAGACAAAAAAGGTATCGATCAAAAA ATCGCAGTTTACGATTTAGGTGGAGGTACTTTCGATATTTCTATCCTAGAATTAGGAGAT GGTGTATTTGAAGTATTGTCTACAAATGGAGATACACACTTAGGTGGAGATGATTTTGAC CAAACAATCATAGACTGGTTGGCAGATGAGTTTAAAGCTGAAGAAGGAATTGACTTGCGT CTTGACCCAATGTCATTACAAAGAATTAAAGAAGCTGCTGAAAAAGCTAAAATCGAGTTA TCATCTTCTGCTGAAACAGAAATTAACTTGCCATACGTTACCGCTACTGCTTCTGGACCA AAACACTTAGTTAAAAAATTAACAAGAGCTAAATTTGAGCAATTGTCTGATACTTTAGTA AAACGTTCTATGGAACCAGTTGCTAAAGCATTAAAAGATGCAGGTTTAACTGTAAAAGAT ATCGACGAAGTTATCCTTGTGGGTGGTTCTACAAGAATGCCAAGAATTGCTGACGAAGTG GAGAAATTCTTTGGTAAAAAAGCCTCTAAAGGAGTTAACCCTGATGAAGTTGTTGCT

fumC (849 bp)

ATAGGACCATCAGCATCGATGCCTAAAGAAATCATAGAAGGTTTTGCATACTTAAAAAAA GCAGCCGCTTATGCTAATTGCGATTTAGGTGTTTTACCAACAGAAAAACGTGATGCCATT GCAGCCGTTTGCGACGAAATATTAGCCGGAAAACTAGACGATGAGTTTCCCTTAGTAATC TGGCAAACAGGTTCAGGAACACAAAGCAATATGAACGTAAATGAAGTTGTAGCTAATCGC GCTCAAGTGCTAGCAGGACACAAAATAGGCGAAGGCGAACAATTTATAAAAGCCAATGAT GACGTAAACAAATCACAATCATCTAACGATACGTACCCAACAGGAATGCACATCGCAGCT TATAAAGCAGTTGTAGAAATTACCATTCCAGGTCTAGAAAAATTACGTGATACATTACAA GCCAAAGCAACAGCCTATAACAATATCGTAAAAATAGGTCGCACACACCTTATGGATGCA ACACCGCTAACATTAGGTCAGGAAATTTCTGGTTATGTAGCACAACTAAACTACGGAATA AAAGCAGTAAAAAACACATTAGCACACTTATCCGAAGTAGCACTTGGCGGAACAGCCGTA GGAACAGGGCTAAACACACCAGCGGGTTATGATGTAAAAGTTGCGCAATATATTGCGCAA TTTACAGGACATCCGTTTGTAACAGCACCCAACAAATTTGAAGCATTAGCAGCACATGAC GCTATTGTAGAAACACATGGAGCGCTAAAACAAATTGCCGTTTCATTAAACAAAATTGCA AACGATGTTCGCATGTTAGCCTCAGGACCACGTTCAGGAATTGGAGAAATCTTAATTCCA GAAAACGAG

gyrB (1149 bp)

GGATTGCACGGAGTAGGGGTTTCTGTAGTAAATGCTTTGTCAAACCACTTGCGAGCAACC GTTCATAGTAGCGACGGAAAGATTTACGAGCAAGAATACGAAAAAGGAAAAGCACTTTAT CCTGTAAAGCAAATAGGCGAAACGACTAAACGTGGAACCATTGTAACTTTTTACCCGGAC CCTTCTATTTTTACCCAAACCATAGAGTATTCTTATGACACTTTATCTGCTCGTATGCGT GAATTATCTTTTTTAAATAAAGGAATCACCATTACTTTTACAGATAAAAGAGAAAAAGAC AAAGACGGAAATTTTGTTTCAGAAATTTTTCATTCAACAGAAGGACTAAAAGAATATATC CGTTATTTAGATGGAAACCGAGAGCCAATTATTGCGCACGTAATTTCTATGGATAACGAT AAAGGAGAGATTCCAGTTGAGGTTGCCTTAATTTATAATACAAGTTATACAGAGAATATT TTTTCTTACGTAAACAATATCAATACACACGAAGGAGGAACGCATTTGCAAGGTTTTAGA ACTGGTTTAACCCGTTCGTTAAAGAAATATGCAGACTCGTCTGGAATGTTAGATAAATTG AAATTTGAAATTTCAGGAGATGACTTCCGTGAAGGATTAACAGCGATTATTTCGGTAAAA GTTGCTGAACCTCAATTTGAAGGTCAAACCAAAACCAAATTAGGAAATAGAGAAGTAGTT TCTCCAGTTTCTCAAGCGGTTGGCGATATGATTGAAAATTATTTGGAAGAAAATCCAAAT GATGCAAGAATCATTGTGCAAAAAGTAATTTTGGCAGCACAAGCACGTCATGCTGCTAAG AAAGCCCGTGAAATGGTGCAGCGAAAAACCGTAATGGGTGGTGGTGGCTTACCAGGAAAA CTATCAGATTGTTCTGAACAAGATCCAGCAAAATGTGAAGTATTTCTTGTTGAGGGAGAT TCGGCAGGAGGAACGGCAAAACAAGGACGTGATAGGGCTTTTCAGGCAATTTTGCCTTTG CGTGGTAAGATTTTGAATGTTGAAAAAGCAATGCATCACAAGGTTTTTGAAAACGAAGAA ATTCGTAATATATTTACAGCATTGGGGGTAACTATTGGTACAGCCGAAGACAGTAAAGCA TTAAACCTA

murG (825 bp)

TATCCTGCAATTGCCATTGCAAATGAGTTGAAATCTCGTTTTCCTAATTGCAAAATCCTT TTTGTAGGGGCAAAAGACAAAATGGAAATGCAAAAAGTACCACAAGCAGGTTATGATATA AAAGGATTAAGCATTGCAGGGCTACAAAGAAAAATAACTTTGCAAAACGCAATGTTTCCC TTTAAGTTGTTGTCAAGTTTGGTTAAATCATTCGGAATCGTACAACAATTCAAGCCCGAT GTTGTTATAGGAACTGGAGGATTTGCCAGCGGCGCAGTGCTTAAAGTTGCTTCAATATTG GGAATTGCAACAGTGATACAAGAACAAAATTCTTATCCTGGAATTACCAATAAATTATTA AGTAAAAAAGCCAATAAAATATGTGTGGCTTACGAAAATTTGGAACAATTTTTTCCAAAA GATAAAATGATATTAACTGGAAATCCTGTTCGTCAGGATTTAATTTCAGTCGATGGCAAA CGAAATGAAGCAATTGATTATTTTAAATTAGACGCAAATAAAAAAACAATATTAATCCTT GGCGGAAGCCTTGGTGCCAGAAGAATTAATCAATTAATTGCAAAAGAAATAGATTGGTTA TTGTCGCAAAATGTTCAAATTATTTGGCAATGTGGCAAATTGTATTTTGAAGATTACAAG CCTTTTTCAGGCAAAGAAAATGTACAGATTTTATCATTTATAGACAGAATGGATTTGGTT TATGCTGCTGCCGATATTGTAATATCTCGTTCAGGAGCCTCGTCAGTATCAGAATTAGCC ATTGTAGGAAAGCCAGTTATTTTCATTCCGTCGCCTAATGTTGCT

trpB (933 bp)

ACTCCACTTTATTTTGCCGAGAGATTATCAAAAGAATACAATACAAAAATTTATCTAAAA AGAGAAGATTTATGCCATACAGGCGCACACAAAGTAAACAATACCATTGGACAAATTTTA CTAGCAAAACGCCTTGGTAAAACCCGTATTATTGCAGAAACTGGCGCAGGACAACACGGA GTAGCCACAGCAACCGTTTGCGCACTCATGGGTTTGCAATGTATTGTTTACATGGGTGAA ATAGACATTAAAAGACAAGCACCAAACGTAGCGAGAATGAAAATGCTCGGTGCCGAAGTT CGTCCCGCAACATCAGGTTCGAAAACCCTAAAAGACGCTACAAACGAAGCCATTCGAGAT TGGATAAACAACCCAACAAACACCTATTACATTATAGGATCCGTAGTTGGTCCGCATCCT TATCCAGATATGGTAGCACGTTTTCAAAGTGTCATTTCCCAAGAAATAAAGACACAATTA TTAGAAAAAGAAGGACAAGAAAATCCAGATTATATCATCGCTTGTGTAGGTGGCGGAAGC AATGCCGCAGGAGCTTTTTATCACTTCCTAGACGAAAAAGAAGTAAACATAATTGCGGTC GAAGCTGCCGGAAAAGGCATAGATTCTGGAGAAAGCGCAGCCACCTCAGCATTAGGCAAA ATAGGAATTATTCACGGAAGCAAAACCCTGCTCATGCAAAGTCCAGACGGACAAATCACA GAACCCTACTCTATCTCCGCAGGATTAGATTATCCCGGAGTTGGCCCCATGCACGCTCAC TTATTCGAAACAAAAAGAGCCCAATTTATCTCCATCACTGATGATCAAGCCATGAATTGG GGCATAAAAATGTCTCAAACCGAAGGCATTATTCCAGCCATAGAAAGCGCACATGCTTTT GCCGTTTTAGACCATAAAAAATTTAAACCAACA

tuf (939 bp)

ATTAATACATCACACGTTGAGTACGAAACTGCTAACCGTCACTACGCACACGTTGACTGT CCTGGTCACGCGGATTACGTAAAGAACATGGTTACTGGTGCTGCTCAAATGGACGGTGCT ATCCTTGTTGTAGCTGCAACTGATGGTCCAATGCCACAAACACGTGAGCATATCCTTTTA GGTCGCCAAGTTGGTATTCCTAGAATGGTAGTGTTCATGAATAAAGTGGATATGGTTGAT GATGAAGAATTATTAGAATTAGTTGAGATGGAAATCAGAGACTTATTATCTTTCTACGAA TATGATGGAGATAATGGTCCTGTAGTTCAAGGTTCGGCTTTAGGAGGATTAAATAATGAT CCTGCTTGGGTTCCTAAAATTATCGAATTAATGGAAGCTTGTGATTCTTGGATCCAAGAG CCAATACGTGATACTGAAAAGCCGTTCTTAATGCCCGTTGAGGATGTATTTACAATTACT GGTCGTGGAACTGTTGCTACAGGTCGTATCGAAACAGGTATCTGTAATACAGGGGATCCA GTTGAGATCATTGGTATGGGTGCTGAGAAATTAACTTCTACAGTAACAGGTATTGAAATG TTCCGTCAAATCCTTGATAGAGGTGAGGCTGGAGATAATGCAGGTATATTGTTAAGAGGT GTTGCAAAAGAAGATATCAAAAGAGGAATGGTTATCATTAAGCCAGGATCTGTAAAGCCA CATGCTAAATTTAAAGCTGAGGTTTATATCTTGAAAAAAGAAGAAGGTGGTCGTCACACA CCATTCCATAATAACTACCGTCCACAGTTTTACGTTCGTACAACTGACGTAACAGGGGTA ATCATGTTGCCTACAGGAGTTGAAATGGTTATGCCAGGTGATAACTTAACTATCGATGTT ACTTTGTTAAGTCCAATTGCTATGAGTGTTGGTTTGCGT

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.