PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Escherichia coli

 

Genes

The Escherichia coli MLST scheme uses internal fragments of the following eight housekeeping genes:

  • dinB (DNA polymerase)
  • icdA (isocitrate dehydrogenase)
  • pabB(p-aminobenzoate synthase)
  • polB (polymerase PolII)
  • putP (proline permease)
  • trpA (tryptophan synthase subunit A)
  • trpB (tryptophan synthase subunit B)
  • uidA (beta-glucuronidase)

PCR amplification

dinB: F : dinBoF GTTTTCCCAGTCACGACGTTGTATGAGAGGTGAGCAATGCGTA
dinB: R : dinB2oR TTGTGAGCGGATAACAATTTCCGTAGCCCCATCGCTTCCAG
icdA : F : icd2oF GTTTTCCCAGTCACGACGTTGTAATTCGCTTCCCGGAACATTG
icdA : R : icdoR TTGTGAGCGGATAACAATTTCATGATCGCGTCACCAAAYTC
pabB : F : pabB2oF GTTTTCCCAGTCACGACGTTGTAAATCCAATATGACCCGCGAG
pabB: R : pabBoR TTGTGAGCGGATAACAATTTCGGTTCCAGTTCGTCGATAAT
polB : F : polB2oF GTTTTCCCAGTCACGACGTTGTAGGCGGCTATGTGATGGATTC
polB : R : polBoR TTGTGAGCGGATAACAATTTCGGTTGGCATCAGAAAACGGC
putP : F : putP2oF GTTTTCCCAGTCACGACGTTGTACTGTTTAACCCGTGGATTGC
putP : R : putPoR TTGTGAGCGGATAACAATTTCGCATCGGCCTCGGCAAAGCG
trpA : F : trpAoF GTTTTCCCAGTCACGACGTTGTAGCTACGAATCTCTGTTTGCC
trpA : R : trpAoR TTGTGAGCGGATAACAATTTCGCTTTCATCGGTTGTACAAA
trpB: F : trpB2oF GTTTTCCCAGTCACGACGTTGTACACTATATGCTGGGCACCGC
trpB: R : trpBoR TTGTGAGCGGATAACAATTTCCCTCGTGCTTTCAAAATATC
uidA : F : uidAoF GTTTTCCCAGTCACGACGTTGTACATTACGGCAAAGTGTGGGTCAAT
uidA : R : uidAoR TTGTGAGCGGATAACAATTTCCCATCAGCACGTTATCGAATCCTT

PCR amplification is performed at an annealing temperature of 55°C for all genes.

Sequencing

We use the same primers for sequencing all genes:

oF : GTT TTC CCA GTC ACG ACG TTG TA
oR: TTG TGA GCG GAT AAC AAT TTC

Allele templates

dinB (450 bp)

CCTGCCCTGCGCGATATCCCTATTGCTATTGGCGGCAGCCGCGAACGTCGGGGGGTGATCAGCACCGCCAATTATC CCGCGCGTAAATTTGGCGTACGTAGCGCTATGCCGACAGGGATGGCGCTCAAATTTTGCCCACATCTCACGCTGCT TCCAGGGCGCTTTGACGCCTACAAAGAAGCCTCAAATCATATCCGCGAAATTTTCTCGCGCTATACCTCGCGCATT GAACCGTTATCACTGGATGAAGCCTATCTCGACGTCACCGATAGTGTGCATTGCCACGGTTCTGCGACCCTCATCG CCCAGGAAATCCGCCAGACAATCTTCAACGAGCTGCAACTGACGGCGTCTGCGGGCGTTGCGCCGGTAAAGTTTCT CGCTAAAATCGCTTCCGACATGAATAAACCCAACGGTCAGTTTGTGATTACTCCGGCAGAAGTTCCGGCA

icdA (516 bp)

ATCGAATACGCAATTGCTAACGATCGTGACTCTGTGACCCTGGTGCACAAAGGCAACATCATGAAGTTCACCGAAG GCGCGTTTAAAGACTGGGGCTACCAGCTGGCGCGTGAAGAGTTTGGCGGTGAACTGATCGACGGCGGCCCGTGGCT GAAAGTTAAAAACCCGAATACCGGCAAAGAGATCGTCATTAAAGATGTGATTGCTGATGCATTCCTGCAACAGATC CTGCTGCGTCCGGCTGAATATGATGTTATCGCCTGTATGAACCTGAACGGTGACTACATTTCTGACGCTCTGGCTG CACAGGTCGGCGGTATCGGTATCGCCCCAGGCGCAAACATCGGTGACGAATGCGCCCTGTTTGAAGCCACCCACGG TACTGCGCCGAAATATGCCGGTCAGGACAAAGTAAACCCAGGCTCTATTATTCTCTCCGCTGAGATGATGTTACGC CATATGGGCTGGACTGAAGCCGCAGACCTGATTGTTAAAGGTATGGAAGGCGCAATCAAC

pabB (468 bp)

GGTGATTGCTATCAGGTGAATCTCGCCCAGCGTTTTCATACGACCTATTCTGGCGATGAATGGCAGGCATTCCTTC AGCTTAATCAGGCCAACCGCGCGCCGTTTAGCGCTTTTTTACGTCTTGAACAGGGTGCGATTTTAAGCCTTTCGCC AGAGCGGTTTATCCTTTGTGATAATAGTGAAATCCAGACCCGCCCGATTAAAGGCACGCTACCACGCCTGCCCGAT CCTCAGGAAGATAGCAAACAAGCAGAAAAACTGGCGAACTCAGCGAAAGATCGTGCCGAAAATCTGATGATTGTCG ATTTAATGCGTAATGATATCGGTCGTGTTGCCGTAGCCGGTTCGGTAAAAGTACCAGAGCTGTTCGTGGTCGAACC CTTCCCTGCCGTGCATCATCTGGTCAGCACCATAACGGCGCGGCTACCAGAACAGTTACACACCAGCGATCTGCTG CGCGCAGCTTTT

polB (450 bp)

TCGATCATCCGCACCTTTCTGATTGATCCCGTCGGGCTGGTGGAAGGCATGGCGCAGCCTGATCCAGAGCACAGCA CCGAAGGTTTTCTCGATGCCTGGTTCTCGCGGGAGAAACATTGCCTGCCGGAGATTGTGACTAACATCTGGCACGG GCGCGATGAAGCCAAACGTCAGGGTAATAAGCCGCTTTCGCAGGCGCTGAAGATCATTATGAATGCCTTTTATGGC GTGCTTGGCACCACCGCCTGCCGCTTCTTCGATCCGCGCCTGGCGTCGTCGATCACCATGCGTGGTCATCAGATCA TGCGGCAAACCAAAGCGTTGATTGAAGCGCAGGGCTACGACGTGATCTACGGCGATACCGACTCAACGTTTGTCTG GTTGAAAGGCGCACATTCGGAAGAAGAAGCGGCGAAAATTGGTCGTGCACTGGTGCAGCACGTTAACGCC

putP (456 bp)

CTGTCGGCGATTCTGGCGGCGGTAATGTCAACGTTAAGTTGCCAGCTGCTGGTATGTTCCAGTGCGATTACCGAAG ATTTATACAAAGCGTTTCTGCGTAAACAGGCCAGCCAGAAAGAGCTGGTGTGGGTAGGGCGAGTGATGGTGCTGGT GGTGGCGCTGGTGGCGATTGCGCTGGCGGCAAACCCGGAAAACCGCGTGCTGGGCTTAGTGAGCTACGCGTGGGCA GGCTTTGGCGCAGCGTTTGGTCCGGTGGTGCTGTTCTCGGTGATGTGGTCACGCATGACGCGCAACGGTGCGCTGG CGGGGATGATCATCGGTGCGCTGACGGTTATCGTCTGGAAACAGTTCGGCTGGCTGGGTCTGTACGAAATTATTCC GGGCTTTATCTTCGGCAGTATCGGGATTGTAGTGTTTAGTTTGCTGGGTAAAGCGCCGTCAGCGGCGATGCAAAAA

trpA (561 bp)

GGTATCCCCTTCTCCGACCCACTGGCGGATGGCCCGACGATTCAAAACGCCACTCTGCGCGCCTTTGCGGCAGGTG TGACTCCGGCACAATGTTTTGAAATGCTGGCACTGATTCGCCAGAAACACCCGACCATTCCCATTGGCCTGTTGAT GTATGCCAATCTGGTGTTTAACAAAGGCATTGATGAGTTTTATGCCCAGTGCGAAAAAGTCGGCGTCGATTCGGTG CTGGTTGCCGATGTGCCAGTTGAAGAGTCCGCGCCCTTCCGCCAGGCCGCGTTGCGTCATAATGTCGCACCTATCT TCATCTGCCCGCCAAATGCCGATGACGACCTGCTGCGCCAGATAGCCTCTTACGGTCGTGGTTACACCTATTTGCT GTCACGAGCAGGCGTGACCGGCGCAGAAAACCGCGCCGCGTTACCCCTCAATCATCTGGTTGCGAAGCTGAAAGAG TACAACGCTGCACCTCCATTGCAGGGATTTGGTATTTCCGCCCCGGATCAGGTAAAAGCAGCGATTGATGCAGGAG CTGCGGGCGCGATTTCTGGTTCGGCCATT

trpB (594 bp)

GCAGCTGGCCCACATCCTTATCCGACCATTGTCCGTGAGTTCCAGCGGATGATTGGCGAAGAAACCAAAGCACAGA TTCTGGAAAGAGAAGGTCGCCTGCCGGATGCGGTTATCGCTTGTGTTGGCGGCGGTTCAAATGCCATCGGCATGTT TGCTGATTTTATCAACGAAACCGACGTCGGCCTGATTGGTGTCGAACCAGGCGGTCACGGTATCGAAACTGGCGAG CACGGCGCACCGTTAAAACACGGTCGCGTGGGCATCTATTTCGGTATGAAAGCGCCGATGATGCAAACCGAAGACG GACAGATTGAAGAATCTTACTCCATCTCCGCCGGACTGGATTTCCCGTCTGTCGGCCCACAACACGCGTATCTTAA CAGCACTGGACGCGCTGATTACGTGTCAATTACCGATGATGAAGCACTGGAAGCCTTCAAAACGCTGTGCCTGCAC GAAGGGATCATCCCGGCGCTGGAGTCCTCCCACGCCCTGGCCCATGCGCTGAAAATGATGCGCGAAAACCCGGAAA AAGAGCAGCTACTGGTGGTTAACCTTTCCGGTCGCGGCGATAAAGACATCTTCACCGTTCCA

uidA (600 bp)

ATGGAGCATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTA TCACCGTTTGTGTGAACAATGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGATGAAAACGGCAA GAAAAAGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGGATCCATCGCAGCGTAATGCTCTACACCACGCCG AACACCTGGGTGGACGATATCACCGTGGTGACGCATGTCGCGCAAGACTGTAACCACGCGTCTGTTGACTGGCAGG TGGTGGCCAATGGTGATGTCAGCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACCAG CGGGACTTTGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTGTGCGTCACAGCC AAAAGCCAGACAGAGTGTGATATCTACCCGCTGCGCGTCGGCATCCGGTCAGTGGCAGTGAAGGGCGAGCAGTTCC TGATTAACCACAAACCGTTCTATTTTACTGGCTTTGGTCGTCATGAAGATGCGGATTTGCGTGGCAAA

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.