PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Clostridium difficile

 

- Genes

The Clostridium difficile MLST scheme uses internal fragments of the following seven housekeeping genes:

  • aroE (shikimate dehydrogenase)
  • dutA (dUTP pyrophosphatase)
  • gmk (gualynate kinase)
  • groEL (60 kDa chaperonin)
  • recA (recombinase)
  • sodA (superoxide dismutase)
  • tpi (triosephosphate isomerase)

- Primers for PCR amplification

aroE-F : CTAGTAGGTGAAAAACTCTCTCA
aroE-R : ACTGGTGTAGCATTTAATATTATATC

dutA-F : CCTAATTTTGCTCACAAAGGT
dutA-R : AAATCCAGTTGAGCCAAACC

gmk-F : AGGTGCAGGAAAAGGTACTAT
gmk-R : TTCATATGCACAGCTAAATCTC

groEL-F : ATACTGAATTAGATGCTGTTGAAG
groEL-R : TCTGAAGTAGTTTGCTCTACTTG

recA-F : CCAGATACAGGTGAACAGGC
recA-R : TTTAACATTTTCTCTTCCTTGTCC

sodA-F : TATGCATATGATGCACTTGAACC
sodA-R : AAATAGTAAGCATGCTCCCAAAC

tpi-F : GCAGGAAACTGGAAAATGCATAA
tpi-R : CAGATTGGCTCATATGCAACAAC

- Sequencing primers

The same primers as for PCR are used.

- PCR conditions

The PCR mixtures were heated for 3 min at 95C, then a touch-down procedure followed, consisting of 30 s at 95C, annealing for 30 s at temperatures decreasing from 60C to 50C during the first 11 cycles (with 1C decremental steps in cycles 1 to 11), and ending with an extension step at 72C for 30 s. A total of 40 cycles were performed

- Allele templates

aroE (408 bp)

ATCCACAAGAGAGTATTCGAGATATTGAATATTGAAAGTGCTTATAAAAACTTTGAAATTTCAAAAGAAGATATAT CTAAGCTAGACGGTGCTATAAAATTATTAGGAATACAAGGGGTAAATGTTACTGTACCATATAAGGAGCGTATTAT GAAATATCTTGATTTTATATCACCAGAGGCAAAACGTATAGGAGCAGTTAATACAATTTTACTCAGAGAAAATATG TTATATGGTTACAATACAGATTACTTTGGTCTTGATAGTATGTTTAAAATGGCTAATATTGATGTTCAAGGAAAAG TAGCAGTTATATTAGGAACTGGAGGTGCTTCTAAAGCTGCTCTTACATATTTTATTGATTCTGGTATAGAAAAGCT TTATGTTTCAACTAGAAAAAAGGATGAT

dutA (309 bp)

GTTGTAATACCTCCTGGAGAGACTAAACTTATCAAAACTGGGATATGTATAGAGCTTCCTACTATGACAGAAGCGC AGGTAAGACCTAGAAGTGGGCTTGCCTTAAAGCATTCTGTTACTGTATTAAATACACCAGGAACTATTGACGAAGG ATACAGAGGAGAGCTTAAAATTATATTAATAAATCATGGTAAAAATGATTTTAAGGTTGAAAAGCATATGAAAATT GCTCAAATGATAGTAAAACCTATCTATGATATTAACATAGAAGAAGTAAAAGAATTAAGTGACTCCGAAAGAGGAA AAGGT

gmk (279 bp)

AGAAAACCCAGAACTGGAGAAGTTGATGGAGTAAATTATTTCTTCATAAGTAAGGAAAAGTTTGAAGAGATGATAG AAAAAGGTGAGTTTTTGGAGTATGCTCAAATTTATGATAATTTTTATGGAACTCCAAAAGCGGCAATAATGGAATG TTTAGAAAAAGGACAAGATGTATTACTGGAGATTGAAATGCAAGGAGCAAAACAAATAAAAGAAGTTTGCCCAGAG GGAGTATTTATATTTGTACTACCACCATCACTTAAAGAATTAAAAAATAGA

groEL (363 bp)

GAAGCAGTTTTAAATGACCCATATATATTAATTACTGATAAAAAAATATCTAACATACAAGAATTATTACCAGTTC TTGAACAAATAGTTCAACAAGGTAAAAAGCTATTGATAATAGCTGAAGATGTAGAAGGTGAAGCATTATCTACATT AGTAGTAAATAAATTAAGAGGAACATTTGATGTAGTAGCAGTTAAAGCTCCAGGCTTTGGAGATAGAAGAAAAGAA ATGCTTCAAGATATAGCAATACTTACAGGTGCTCAAGTAATATCAGAAGAATTAGGTTATGATTTAAAAGAAGCTG ATTTATCTATGCTAGGTAGAGCTTCATCTGTTAAGGTAACTAAAGAAAGTACTACAATA

recA (378 bp)

GGAGCGATAGATATAATAGTAATAGACTCAGTAGCAGCATTAGTTCCAAAGGCTGAAATAGATGGAGATATGGGTG ATTCTCATGTAGGTTTACAAGCTAGACTTATGTCACAAGCACTTAGAAAGTTAACTGGTTCAATTAAAAAATCAAA TTGTGTTGCTATATTTATAAACCAGTTAAGAGAGAAAGTAGGAATAATGTTTGGAAACCCAGAAACTACTACTGGA GGACGTGCACTAAAATTCTATTCATCAGTTAGATTGGATGTTAGAAAAATAGATACAATAAAACAAGGTGATAAAG TTATAGGTAGTAGAACTAGAGTTAAAGTTGTTAAAAACAAAGTAGCACCACCATTTAAGCAAGCTGAATTTGAT

sodA (408 bp)

CATCATGATAAGCATTATCAAGCTTATGTTGATAAATTAAATGCTGCTCTTGAAAAATATCCTGAGCTTTATAATT ATTCTTTATGTGAATTATTGCAAAATTTAGATTCTTTACCTAAAGATATTGCTACAACTGTAAGAAATAATGCAGG TGGAGCTTATAATCATAAATTCTTTTTTGATATAATGACGCCAGAAAAAACCATACCTTCTGAATCTTTAAAAGAA GCTATTGATAGAGACTTTGGTTCTTTTGAAAAATTTAAGCAAGAGTTCCAAAAATCTGCTTTAGATGTCTTTGGTT CTGGTTGGGCTTGGCTTGTAGCTACTAAAGATGGGAAATTATCTATTATGACTACTCCAAATCAGGATAGCCCTGT AAGTAAAAACCTAACTCCTATAATAGGA

tpi (393 bp)

GAAATTAAAGATAAAGTAAATTCTGATAAAGTAGAAGCTGTTATATGTGCACCATTTACTTTATTAAAGGATTTAA AAGAAGCTACTAAGGGTACAAATATAAAGATAGGTGCTCAAAATATGCACTTTGAAGAAAAAGGAGCATTTACAGG AGAAGTTTCACCTCTTATGTTAAAAGAAATAGATATGGACTATGTTGTAATAGGACATTCAGAAAGAAGACAATAC TTCAATGAAACTGATGAAACTGTAAACAAGAAAGTTTTAAAAGCATTAGAAGTAGGAATAGACCCAATATTATGTG TTGGAGAAACTTTAGAACAAAGAGAAGCTGGAAAAACTAAAGATGTTTGTAAAGTTCAAGTTGAAAAAGCTTTAGA AAATGTTCTTAAA

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.