PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Bifidobacterium

 

- Genes

The Bifidobacterium MLST scheme uses internal fragments of the following seven housekeeping genes:

  • clpC (protease)
  • fusA (GTP-binding protein chain elongation factor EF-G)
  • gyrB (DNA gyrase, subunit B)
  • ileS (isoleucyl-tRNA synthetase)
  • purF (amidophosphoribosyltransferase)
  • rplB (50S ribosomal subunit protein L2)
  • rpoB (beta subunit of RNA polymerase)

- Primers for PCR amplification

clpC : F : ClpC - uni : GAGTACCGCAAGTACATCGAG
clpC : R : ClpC - rev : CATCCTCATCGTCGAACAGGAAC

fusA : F : fusA : B3 : ATCGGCATCATGGCYCACATYGAT
fusA : R : fusA : B4 : CCAGCATCGGCTGMACRCCCTT

gyrB : F : gyrB : B3 : AGCTGCACGCBGGCGGCAAGTTCG
gyrB : R : gyrB : B4 : GTTGCCGAGCTTGGTCTTGGTCTG

ileS : F : ileS : B3 : ATCCCGCGYTACCAGACSATG
ileS : R : ileS : B4 : CGGTGTCGACGTAGTCGGCG

purF : F : PurF - uni : CATTCGAACTCCGACACCGA
purF : R : PurF - rev : GTGGGGTAGTCGCCGTTG

rplB : F : rplB : B3 : GGACAAGGACGGCRTSCCSGCCAA
rplB : R : rplB : B4 : ACGACCRCCGTGCGGGTGRTCGAC

rpoB : F : rpoB : B3 : GGCGAGCTGATCCAGAACCA
rpoB : R : rpoB : B4 : GCATCCTCGTAGTTGTASCC

- PCR conditions

PCR amplification is performed at two annealing temperatures: 55C for ileS and rpoB and 60C for clpC, fusA, gyrB, purF and rplB.

- Sequencing primers

We use the PCR primers also for sequencing.

- Allele templates

clpC (603 bp):

GAGACCATCGAGATCCTGAAGGGCCTGCGTTCCCGTTACGAGAACCACCACCACGTGACCATCACCGATGGCGCGC TGCAGTCCGCCGCAGAGCTGTCCAGCCGGTACATCCAGGACCGTAACCTGCCTGACAAGGCCATCGACCTGATCGA TGAGGCCGGTGCACGCCTGCGCATCAAGCGCCTGACCGCCCCGCCTGAGCTCAAGGAACTCGACGAGAAGATCGCC AAGATCGCCGCCGACAAGGACGAGGCCATCAAGGGCCAGGACTTCGAGAAGGCCGCCGAACTGCGCGACAAGCAGG AGAAGCTGGAAGCCGATCGCAAGCAGAAGGAAGACTCCTGGCGCGAAGGCGAGTCCGACGTCAAGATGGTTGTGGA CGAGGACGTGATCGCCGAGGTCATCAGTTCCACCACCGGTATCCCGGTGTTCAAGCTGACCCAGGCCGAGTCCAAG AAACTGCTCAGCATGGAGACGGAGCTGCACAAGCGCATCATCGGTCAGGATGAAGCGGTTTCCGCTTTGTCACGGT CCATCCGACGCACCCGCGTGGGATTGAAGGACCCGAAGCGCCCGTCCGGCTCGTTCATCTTCGCCGGCCCC

fusA (666 bp):

TACAAGATCGGCGAGACCCACGACGGCGCCTCCACCATGGACTTCATGGCGCAGGAGCAGGAACGTGGCATCACCA TCCAGTCCGCCGCCACCACCTGCTTCTGGAGCCGTCAGTCCCACGACACCAAGGACAAGTTCCAGATCAACATCAT CGACACCCCCGGCCACGTGGACTTCACGGCCGAGGTCGAGCGCTCCCTGCGCGTGCTCGATGGCGCCGTCGCCGTG TTCGACGGCAAGGAGGGCGTGGAGCCGCAGTCCGAGACCGTGTGGCGTCAGGCTGACAAGTACGGCGTTCCGCGCA TCTGCTTCATCAACAAGATGGACAAGCTGGGCGCGAACTTCTACTACTCCGTCGACACCATCAAGGAGAAGCTGGG CGCCGCTCCGATCGTGATGCAGCTGCCGATCGGCGCCGAGAACGACTTCACCGGCGTCGTCGACCTGGTCGAGATG CAGGCCTACGTGTGGAACGGCACCGAGGAGCTCGGCGCCAAGTACGACACCACCGAGATTCCGGACGATCTCAAGG ACAAGGCCCAGGAGTACCACGAGAAGCTCGTGGAAGCCGCCGCCGAAGCCGACGACGAACTCATGAACAAGTTCTT CGAGGACGGCGACCTGTCCAAGGAAGACATCCGCGCCGGCGTGCGCAAGCTCACCATC

gyrB (627 bp):

ATCTCCGTGGTCAACGCACTCTCCACCCGCGTGGACATCGAAGTGCGCCGTCAGGGCTTCCACTGGACCCAGACGT ACATCGACCAGCACCCCACCGCGCCCTTGAAGCAGGGCGAGCCGATGACCGAAGGCGAGTCCACCGGCACGTCCGT GACCTTCTGGGCCGACCCGAAGATTTTCGAGACCACCATCTACGACTTCGAGACGCTGCGCTCCCGCTTCCAGCAG ATGGCCTTCCTGAACAAGGGCCTCAAGATCAGCCTGACCGACGAACGCGAGAACGACCAGGCCGGCGACGAGGTGG CCGGCGACGCGGCGGACGAGCCGGGCGCGAAGCACCAGACCGTCACCTACCAATACCTCAACGGCATCAAGGACTA CGTCGAGTATCTGGTCAAGGTGCGCAAGGCCACGCCGGTGGAAGAGGACGTCATCAGCTTCGAGGCCGAAGACCTG AAGCTCGGCATCTCCGCCGAACTCGCCATGCAGTGGACCACCGCCTACTCCGAGGCCGTGCACACCTTCGCGAACA CGATTTCCACCACCGAGGGCGGCACCCACGAGGAGGGCTTCCGCGCCGCGCTGACCTCGCTGGTCAACCGTTACGC GCGTGACAAGGGCATCCTC

ileS (489 bp):

CTCGGCATCGACTCGGTCGACCAGATCGAGAAGATGGGCATCGACAAGTTCAACGACGCCTGCCGCGCCTCCGTGC TGAAATACACCAACGAATGGCAGAACTACGTGCACCGTCAGGCGCGATGGGTGGACTTCGAGCACGGCTACAAGAC CCTGAACATTCCATACATGGAATCCGTGATGTGGGCCTTCAAGCAGCTCTACGACAAGGGCCTGGCCTACCAGGGG TACCGCGTGCTGCCGTACTGCCCGAAGGACCGCACGCCGCTGAGCGCGCACGAGCTGCGCATGGACGCCGACGTCT ATCAGGATCGCCAGGACACCACCGTGTCCGTGGCCGTGAAGATGCGCGACGAGGAGGACGCCTACGCCGTCTTCTG GACCACCACCCCGTGGACCGTGCCCACCAACTTCGCCATCGTGGTCGGCGCCGACATCGACTACGTCGAGGTGCGC CCGACCGAAGGCAGGTTCGCGGGCAAGAAGTTC

purF (591 bp):

AACGGCGCCTACGTGCTCGCCTCCGAAACCTGCGCCCTCGACGTGGTCGGCGCCGAACTGGTGCGCAACATCCGCC CCGGCGAAATCGTGGTGGTCAACGACCACGGCTACAAGATCGTGCAGTACACCAACAACACGCAGCTGGCCATCTG CTCGATGGAATACATCTACTTCGCCCGTCCGGATTCCGACATCTACGGCGTCAACGTGCACTCCGCCCGCAAGCGC ATGGGCGCGCGTCTGGCGCAGGAGTCCCCGGTCGAGGCCGATATGGTCATCGGCGTGCCGAACTCCTCCCTGTCCG CGGCGTCCGGCTACGCGGAGGCCGCCGGGCTGCCCAACGAAATGGGTCTGATCAAGAACCAGTACGTGGCCCGCAC CTTCATCCAGCCCACACAGGAACTGCGCGAACAGGGCGTGCGCATGAAGCTGTCCGCCGTGCGTGGCGTGGTCAAA GGCAAGCGCGTGGTCGTCATCGACGATTCGATCGTGCGTGGCACCACCTCCAAGCGCATCGTGCAGCTGCTGCGCG AAGCCGGCGCCGCCGAAGTGCACATGCGCATCAGCTCGCCGCCACTCAAATACCCGTGC

rplB (357 bp):

GCAGATGGCGAGAAGCGCTACATCATCGCGCCGAAGGGCATCAAGCAGGGCGACGTCATCGAGACCGGTGCTCAGG CTGATATCAAGCCGGGCAACAACCTGCCGCTGAAGAACATCCCGACCGGTACCGTGGTTCATGCCATCGAGCTCCG CCCGCTGGGTGGCGCCAAGATCGCTCGTTCCGCTGGTGCCGCCGTTCAGCTCGTCGCCAAGGATGGCGCCTACGCT CAGCTGCGTATGCCGTCCGGCGAAATCCGCAACGTCGACGCGCGCTGCCGCGCTACCGTCGGCGAGGTCGGCAACG AGGACCACGCCAACATTCAGCTCGGCAAGGCTGGCCGCGCCCGCTGGATCGGC

rpoB (501 bp):

TCCCACTTCGGCCGTATGTGCCCGATCGAGTCTCCTGAAGGCCCGAACATCGGTCTGATCGGCTCCCTAGCAACCT TCGGCCGCGTCAACCCGTTCGGCTTCATCGAGACCCCGTACCGCAAGGTCGTCAACGGCCATGTGACCGACGAGGT CGAGTACATGACCGCTGACCGCGATCTTGACCACGTCATCGCCCAGGCCAACCAGGAGCTCGACGAGAACGGCAAC TTCGTCTCCAAGTCCGCCCTTGCCCGAGTCGGCGAGGAAGAGGCGGTCGATGTGCCGGTGAGCTCCGTGGATTACA TGGACGTCTCCCCGCGTCAGATGGTCTCCCTCGGTGCCTCCCTGATCCCGTTCCTGGAGCATGATGAGGGCCACCG TGCACTGATGGGTACCAACATGCAGCGTCAGGCCGTGCCGCTGATCGAATCCGAGCGCCCGCTGGTGGGCACCGGC TCCGAATGGCGCGCCGCCAACGACTCCGGCGACGTCATCAAGTCC
Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.