PF8
Genotyping of Pathogens and Public Health Platform
Institut Pasteur
25-28, Rue du Docteur Roux
75724 Paris Cedex 15

FRANCE

Tel + (33) 1 45 68 83 24
Fax + (33) 1 40 61 39 43

 

Primers used for MLST of Acinetobacter baumannii

 

- Genes

The Acinetobacter baumannii (and closely related species) MLST scheme uses internal fragments of the following seven housekeeping genes:

  • cpn60 (60-KDa chaperonin)
  • fusA (elongation factor EF-G)
  • gltA (citrate synthase)
  • pyrG (CTP synthase)
  • recA (homologous recombination factor)
  • rplB (50S ribosomal protein L2)
  • rpoB (RNA polymerase subunit B)

- Primers for PCR amplification

cpn60:F:cpn60F ACTGTACTTGCTCAAGC
cpn60:F:cpn60R TTCAGCGATGATAAGAAGTGG

fusA:F:fusA7 ATCGGTATTTCTGCKCACATYGAT
fusA:R:fusA8 CCAACATACKYTGWACACCTTTGTT

gltA:F:gltAF AATTTACAGTGGCACATTAGGTCCC
gltA:R:gltAR GCAGAGATACCAGCAGAGATACACG

pyrG:F:pyrG7 GGTGTTGTTTCATCACTAGGWAAAGG
pyrG:R:pyrG8 ATAAATGGTAAAGAYTCGATRTCACCMA

recA:F:RA1 CCTGAATCTTCYGGTAAAAC
recA:R:RA2 GTTTCTGGGCTGCCAAACATTAC

rplB:F:rplB7 GTAGAGCGTATTGAATACGATCCTAACC
rplB:R:rplB8 CACCACCACCRTGYGGGTGATC

rpoB:F:Vic4 GGCGAAATGGC(AGT)GA(AG)AACCA (Please note: This primer sequence was corrected on Sept. 18th, 2009)
rpoB:R:Vic6 GA(AG)TC(CT)TCGAAGTTGTAACC

PCR amplification is performed at an annealing temperature of 50°C for all genes.

- Primers for Sequencing

We use the PCR primers for sequencing on both strands.

- DNA Extraction :

1. Resuspend one white loop (1 l) of 24h plate culture of bacteria in 200 l of sterilized and free DNA water.
2. Heat 10 min at 96 C
3. Centrifuge 5 min at 13000 rpm
4. Pipet the supernatant and put it in 1.5 ml Eppendorf tube.

- PCR amplification :

1.For each sample : 50 µl final volume

Water : 34 µl 10X Buffer : 5 µl
MgCl2 (25mM) : 3 µl
dNTP (1.25mM each) : 4 µl
Primer 1 (10 uM) : 1 µl
Primer 2 (10 uM) : 1 µl
Taq invitrogen (ref : 18038-026) 5 U/µl : 0.17 µl

2. Add 2 µl of DNA (10 ng/µl) in 48 µl of mix.

3. After the PCR cycle, migrate the PCR product (4µl of PCR product + 3 µl of blue) in a 1% agarose gel (100 ml of TBE 0.5X + 1g of agarose + 2 drops of BET).

Cycle :

94°C   2 min

94°C   30 sec
50°C   30 sec   *35
72°C   30 sec

72°C   5 min

- PCR purification :

1. In a 96 Millipore plate (purple), put in each well 46 l of purified PCR product and 54 l of sterilized and free-DNA water.
2. Filtration over 10 min
3. Put 50 l of sterilized and free -DNA water in each well of the plate.
4. Mix on a vortex over 10 min.
5. Transfer the purified PCR product in a plate.

- Sequence reaction :

1.Mix preparation for one reaction (one strain, one gene, one primer)

Water : 5 l
5X Buffer : 1 l
Primer (4M) : 1 l
BigDye V1.1 : 1 l

2. Put 2 l of purified PCR product in 8 l of mix
3. Sequence cycling

- Sequence purification :

1. To each well of the plate, add 1 l of sodium acetate 3M, 1 l of EDTA 125 mM and 50 l of 95 % ethanol
2. Turn down the plate 10 times
3. Centrifuge 30 min at 3300 rpm
4. Throw out the supernatant
5. Return the plate on a paper and centrifuge it 1 min at 1000 rpm
6. Add 50 l of 70 % ethanol
7. Centrifuge 15 min at 3300 rpm
8. Throw out the supernatant
9. Return the plate on a paper and centrifuge it 1 min at 1000 rpm
10. Dry the plate on the lab table over 15 min
12. Conserve the plate at -20C

- Allele templates

cpn60(405 bp)

ATGAACCCAATGGATTTAAAACGCGGTATCGACATTGCAGTAAAAACTGTAGTTGAAAATATCCGTTCTATTGCTAAACCAGCTGAT GATTTCAAAGCAATTGAACAAGTAGGTTCAATCTCTGCTAACTCTGATACTACTGTTGGTAAACTTATTGCTCAAGCAATGGAAAAA GTAGGTAAAGAAGGCGTAATCACTGTAGAAGAAGGTTCTGGCTTCGAAGACGCATTAGACGTTGTAGAAGGTATGCAGTTTGACCGT GGTTATATCTCTCCGTACTTTGCAAACAAACAAGATACTTTAACTGCTGAACTTGAAAATCCGTTCATTCTTCTTGTTGATAAAAAA ATCAGCAACATTCGTGAATTGATTTCTGTTTTAGAAGCAGTTGCTAAAACTGGTAAA

fusA (633 bp)

ATTGGTGAAGTACACGACGGTGCAGCAACAATGGACTGGATGGAACAAGAGCAAGAGCGTGGTATTACAATTACCTCTGCTGCAA CAACTTGTTTCTGGTCTGGTATGGGTAACCAATTCCCACAACACCGTATCAACGTAATTGATACACCGGGACACGTTGACTTCACA ATCGAAGTTGAGCGTTCTATGCGTGTTCTTGACGGTGCTTGCATGGTTTACTGTGCAGTTGGTGGTGTACAGCCTCAGTCTGAAAC TGTATGGCGTCAGGCTAACAAATATAAAGTGCCTCGTTTAGCATTCGTGAACAAGATGGACCGTACTGGTGCAAACTTCTTCCGTG TTGTTGAACAAATGAAAACACGTCTTGGTGCGAATCCTGTGCCAATCGTTGTGCCAATCGGTGCTGAAGACACATTCACTGGTGTA GTTGACCTTATCGAAATGAAGGCAATTATCTGGGATGAAGCTTCTCAAGGTATGAAGTTTGAATACGGCGAGATTCCAGCTGACCT AGTTGATACTGCTCAAGAATGGCGTACAAACATGGTTGAAGCTGCTGCTGAAGCTTCTGAAGAGTTAATGGACAAGTACCTTGAAG AGGGTGATCTTTCTAAAGAAGACATCATCGCA

gltA (483 bp)

GATCCTGGTTTTATGGCGACAGCTTCATGCGAGTCTAAAATCACATTTATCGATGGTGACAAAGGTATTTTATTACACCGCGGTTAC
CCGATTGACCAGTTAGCGACTCAAGCAGACTACCTTGAAACTTGTTATTTATTATTAAATGGCGAGTTACCAACTGCTGAACAAAAA
GTTGAGTTCGATGCGAAAGTTCGTGCTCATACTATGGTTCATGATCAAGTTAGCCGTTTCTTCAATGGTTTCCGTCGTGATGCTCAC
CCTATGGCAATCATGGTTGGTGTAGTAGGCGCATTATCTGCTTTCTATCACAACAACCTTGACATTGAAGACATCAATCACCGCGA
AATTACTGCGATTCGTTTGATTGCTAAAATTCCAACGCTTGCTGCTTGGAGCTACAAATATACTGTAGGTCAGCCATTCATCTATCC
ACGTAATGACTTAAATTATGCGGAAAACTTCTTACACATGATGTTTGCA

pyrG (297 bp)

AAAGTCACAATGGTTAAAATGGATCCTTATATTAATGTCGATCCAGGGACAATGAGCCCATTCCAGCATGGTGAAGTTTTTGTTACC
GAAGATGGTGCAGAAACAGATCTGGATCTGGGTTATTACGAACGTTTCTTACGTCGCGCGAAAATGACCAAACTAAACAACTTCAC
TAGTGGTCGTGTATATCAAGACGTTTTAAATAAAGAGCGTCGTGGTGATTACTTAGGTGGTACAGTTCAGGTTATTCCTCATATTAC
CGACAATATTAAAGAACGTGTACTCCGCGCGGGCGAA

recA (372 bp)

TTACAAGCAATTGCTCAATGTCAAAAATCTGGTGGTACATGTGCCTTCATTGATGCTGAGCACGCCCTAGACCCTCAATATGCACG
CAAACTTGGTGTAGATATTGATAACCTACTTGTTTCACAACCCGACAATGGTGAGCAAGCACTTGAAATTGCTGACATGCTTGTCCG
TTCAGGCGCAATTGATTTAATCGTTGTGGACTCGGTGGCTGCACTTACACCTAAAGCAGAAATCGAAGGTGAGATGGGTGACTCTC
ATATGGGTCTACAAGCGCGTCTTATGAGCCAGGCACTTCGTAAAATTACGGGTAATGCTAAACGTTCAAACTGTATGGTTATCTTCA
TTAACCAGATTCGTATGAAAATTGGT

rplB (330 bp)

CGTCGTTATATCATTGCGCCTAAAGGCTTACGTGCTGGTGATAAAGTACAATCTGGTAACGATGCTCCAATTCGTCCAGGTAACTG
TTTACCACTTCGTAACATGCCAATCGGTTCTACACTTCATAACGTTGAACTTAAAATCGGTAAAGGTGCTCAATTAGCACGTTCTGC
TGGTGCTTCTGTTCAATTGTTGGGTCGTGATGGTTCTTACGCAATCATTCGTCTTCGTTCAGGCGAAATGCGTAAAGTACACGTTGA
ATGCCGCGCTGTAATTGGTGAAGTTTCTAACCAAGAAAACAACCTTCGCTCATTAGGTAAAGCTGGTGCT

rpoB (456 bp)

CAAACTCACTATGGTCGTGTTTGTCCAATTGAAACTCCTGAAGGTCCAAACATTGGTTTGATCAACTCGCTTTCTGTATACGCAAAA
GCGAATGACTTCGGTTTCTTGGAAACTCCATACCGCAAAGTTGTAGATGGTCGTGTAACTGATGATGTTGAATATTTATCTGCAATT
GAAGAAGTAGGCACTGTTATTGCACAGGCCGACTCTGCAGTAGATAAAGATGGCAACTTAACAGAAGAATTCGTTTCTGTTCGTCA
TCAAGGTGAATTCGTACGTATGCCGCCTGAAAAAGTAACGCATATGGACGTTTCTGCACAGCAGGTAGTATCTGTTGCTGCATCAC
TTATTCCATTCCTTGAACACGATGACGCAAACCGTGCGCTCATGGGTTCAAACATGCAACGTCAGGCAGTTCCTACTTTACGTGCG
GATAAACCGCTTGTAGGTACAGGT

Portail Institut Pasteur Accueil Debut de Page
 
Databases are maintained by Sylvain Brisse using software developed by Keith Jolley at Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). Web managers : Ghislaine GUIGON and Jean-michel THIBERGE

This site is hosted by the technological platform Genotyping of Pathogens and Public Health of Institut Pasteur.